G943827 (LOC106579585)



Basic Information


Item Value
gene id G943827
gene name LOC106579585
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 12251980 ~ 12252197 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1076365
CTTTTCAGAAGTTTGTCGGCACATTCCTTGTCTCCGCCACCATAGTTCTCTTTGACGTGGAGGGCGTCGTAGGTGAGTGTGTACTCCGTCTCGTCGTTGTAGTTGGGCCCTAAGAGGGTCCGTGCCCAGATGCCCATGTCATACGGCGGCAGCGTGCCACCGAACTCGGACGGCAGACAATCGGGTAGAATTAACTGGTGTAAACTGTTGAGATTGTT

Function


NR:

description
PREDICTED: clavesin-1-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1076365 True 218 lncRNA 0.54 1 12251980 12252197
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110535277 LOC106579584 coding upstream 5623 12193405 ~ 12246357 (+)
LOC110535276 LOC106579583 coding upstream 60572 12176913 ~ 12191408 (+)
LOC110535275 NA coding upstream 171086 12080263 ~ 12080894 (+)
LOC110535274 LOC100136506 coding upstream 366214 11798079 ~ 11885766 (+)
LOC110535272 LOC106579661 coding upstream 703740 11545457 ~ 11548240 (+)
LOC110535283 LOC106579606 coding downstream 12868 12265065 ~ 12274786 (+)
LOC110535281 riok3 coding downstream 23085 12275282 ~ 12283258 (+)
rmc1 mic1 coding downstream 31684 12283881 ~ 12295047 (+)
LOC110535284 LOC106579588 coding downstream 117881 12370078 ~ 12384286 (+)
LOC110535285 LOC106579590 coding downstream 141176 12393373 ~ 12400089 (+)
G943820 LOC106583515 non-coding upstream 82534 12168999 ~ 12169446 (+)
G943817 NA non-coding upstream 87444 12164268 ~ 12164536 (+)
G943787 NA non-coding upstream 129365 12117079 ~ 12122615 (+)
G943785 NA non-coding upstream 136819 12114827 ~ 12115161 (+)
G943750 NA non-coding upstream 196463 12055140 ~ 12055517 (+)
G943829 NA non-coding downstream 49 12252246 ~ 12253319 (+)
G943877 NA non-coding downstream 67579 12319776 ~ 12343587 (+)
G944232 NA non-coding downstream 128253 12380450 ~ 12381622 (+)
G944423 NA non-coding downstream 374403 12626600 ~ 12626805 (+)
G944512 NA non-coding downstream 486674 12738871 ~ 12739358 (+)
G942702 NA other upstream 1140644 11110726 ~ 11111336 (+)
G941893 NA other upstream 2006474 10245109 ~ 10245506 (+)
LOC118937463 NA other upstream 3396543 8845565 ~ 8855476 (+)
G940376 NA other upstream 3599459 8651504 ~ 8652993 (+)
G940313 NA other upstream 3711113 8532540 ~ 8540867 (+)
G944957 NA other downstream 1135353 13387550 ~ 13394875 (+)
G946426 ramp3 other downstream 1812351 14064548 ~ 14065869 (+)
LOC110535304 NA other downstream 1903157 14154784 ~ 14202999 (+)
G946644 NA other downstream 2058378 14310575 ~ 14314318 (+)
G946643 NA other downstream 2065811 14318008 ~ 14318623 (+)

Expression


G943827(LOC106579585) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

G943827(LOC106579585) Expression in each Bioproject

Bar chart with 1 bar.
G943827(LOC106579585) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 4.
End of interactive chart.

Co-expression Network