G945733



Basic Information


Item Value
gene id G945733
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 13031689 ~ 13089169 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1078443
atatacagggggtaccggtacagagtcaatgtggaggctatatacagggggtaccggtacagagtcaatgtggaggctatatacagggggtaccggcacagagtcaatgtggaggctatatacagggggtacaaattagtatttgtgtcattctcaaagcttttggccacgactgtacagttgaagtcggaagtttacatacaccttagccaaatacatttaaactcagtttcacaattcctgacatttaatcctggtaaaaattccctgtcttaggtcagttaggatcaccactttattttaagaatgtgaaatgtcagaataat

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1078443 True 326 lncRNA 0.41 2 13031689 13089169
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110535288 LOC106579597 coding downstream 4594 12896494 ~ 13027095 (-)
LOC110535290 LOC106579596 coding downstream 138732 12882858 ~ 12892957 (-)
hs6st1b LOC106579591 coding downstream 489431 12454097 ~ 12542258 (-)
LOC118937466 LOC106579607 coding downstream 664282 12366214 ~ 12367407 (-)
LOC110536549 LOC106579607 coding downstream 665562 12348249 ~ 12366127 (-)
LOC110535292 LOC106579599 coding upstream 5391 13094560 ~ 13319271 (-)
xrcc2 LOC106579578 coding upstream 237702 13326871 ~ 13337384 (-)
LOC110535297 LOC106579566 coding upstream 724955 13814124 ~ 13817469 (-)
LOC110536603 nme8 coding upstream 729653 13818822 ~ 13823897 (-)
LOC110535299 LOC106579561 coding upstream 766002 13855171 ~ 13860831 (-)
G945638 LOC106579598 non-coding downstream 53727 12855994 ~ 12977962 (-)
G945618 NA non-coding downstream 150541 12877877 ~ 12881148 (-)
G945551 NA non-coding downstream 252644 12740370 ~ 12779045 (-)
G945550 NA non-coding downstream 291664 12739821 ~ 12740025 (-)
G945515 NA non-coding downstream 350314 12681030 ~ 12681375 (-)
G945827 NA non-coding upstream 125012 13214181 ~ 13214578 (-)
G945912 NA non-coding upstream 260591 13349760 ~ 13349970 (-)
G945986 NA non-coding upstream 400606 13489775 ~ 13489976 (-)
G945991 NA non-coding upstream 408200 13497369 ~ 13497674 (-)
G946101 NA non-coding upstream 536736 13625905 ~ 13626547 (-)
G945345 LOC105027308 other downstream 637551 12393397 ~ 12394138 (-)
LOC110536548 LOC106579654 other downstream 1951172 11061866 ~ 11143146 (-)
G942483 LOC106590343 other downstream 2287012 10743314 ~ 10744677 (-)
G942454 NA other downstream 2389046 10639629 ~ 10642643 (-)
ly86 NA other upstream 1223343 14308595 ~ 14315733 (-)
mtfr1 LOC106579534 other upstream 1795166 14884317 ~ 14897579 (-)
G947750 NA other upstream 2117262 15206431 ~ 15209597 (-)
G947894 LOC106579543 other upstream 2276781 15365950 ~ 15366301 (-)
pan3 pan3 other upstream 2362158 15439415 ~ 15455911 (-)

Expression


G945733 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G945733 Expression in each Bioproject

Bar chart with 20 bars.
G945733 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network