G947894 (LOC106579543)



Basic Information


Item Value
gene id G947894
gene name LOC106579543
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 15365950 ~ 15366301 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1080827
TCATACAAGGATTCCAAAGAGACCAACGTGTGTCAGTTGTCATGTTGGACACATTGTCTGTTTTCTGCCAGGTATCCAACATCAGCCGTTATCCCTGGGCAGCTCTTACCATCCTCCATCAGGACCCCCCAGCCCGTGACGTGGCAGCTGGTCCCGGTGGTGAAGGCGTGGGAAGAGGCGGGGACACAGACGGGCTGTACCAAGTCATTGAAGTAGACAGGGGTGCTGAGCTCCAGCAGGGCGATGTCGTAGTCAGAGGTGAACTGGTCGTACTGGGAGTGGAGGATGATACGACGGATCTGTCTGGTGGCTGCAGCGTTGCTGGCCGTGTTCATCACACGCACGCCCATGT

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1080827 True 352 TUCP 0.57 1 15365950 15366301

Neighbor


gene id symbol gene type direction distance location
LOC110535333 LOC106590438 coding downstream 97293 15251271 ~ 15268657 (-)
LOC118937468 NA coding downstream 144920 15219006 ~ 15221030 (-)
LOC110535332 LOC106579536 coding downstream 283183 15080524 ~ 15082767 (-)
mtfr1 LOC106579534 coding downstream 468371 14884317 ~ 14897579 (-)
LOC110535328 dnjc5 coding downstream 525291 14830974 ~ 14840659 (-)
pan3 pan3 coding upstream 73114 15439415 ~ 15455911 (-)
pdx1 pdx1 coding upstream 114197 15480498 ~ 15485495 (-)
si:ch211-140b10.6 polr1d coding upstream 125536 15491837 ~ 15497193 (-)
rpl21 rpl21 coding upstream 160136 15526437 ~ 15530037 (-)
wasf3b LOC106579509 coding upstream 181377 15547678 ~ 15570639 (-)
G947891 NA non-coding downstream 2559 15363052 ~ 15363391 (-)
G947879 tmprss7 non-coding downstream 30450 15335213 ~ 15335500 (-)
G947847 tagln3 non-coding downstream 85689 15279526 ~ 15280261 (-)
G947818 NA non-coding downstream 115317 15249885 ~ 15250633 (-)
G947838 NA non-coding downstream 117006 15248713 ~ 15248944 (-)
G947899 NA non-coding upstream 2586 15368887 ~ 15369196 (-)
G947933 NA non-coding upstream 36172 15402473 ~ 15405013 (-)
G947936 NA non-coding upstream 40684 15406985 ~ 15407199 (-)
G947941 NA non-coding upstream 42503 15408804 ~ 15409126 (-)
G948145 NA non-coding upstream 62081 15428382 ~ 15428623 (-)
G947750 NA other downstream 156353 15206431 ~ 15209597 (-)
ly86 NA other downstream 1050264 14308595 ~ 14315733 (-)
G945345 LOC105027308 other downstream 2971812 12393397 ~ 12394138 (-)
LOC110536549 LOC106579607 other downstream 3007071 12348249 ~ 12366127 (-)
LOC110535357 LOC106579444 other upstream 434474 15800721 ~ 15810494 (-)
LOC110536560 LOC106579448 other upstream 508028 15873634 ~ 15899014 (-)
drd3 LOC106579486 other upstream 623333 15988295 ~ 16040205 (-)

Expression


G947894(LOC106579543) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.6.
End of interactive chart.

G947894(LOC106579543) Expression in each Bioproject

Bar chart with 3 bars.
G947894(LOC106579543) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 5.
End of interactive chart.

Co-expression Network