G947999



Basic Information


Item Value
gene id G947999
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 15518492 ~ 15518714 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1080970
AGGAGCACACAGACCTCTTGGCTATTTTAAGTGCCATTTCTTCAACAAGATCACCCCTCCCCTGGATGAAAGGAACAGACTTTAGAACACGATATGAAAGTGCCATTATTGGAGGCACTTAGTAAATGCCCCTCAACCGAATATTATTGCTAAACATGTTGCATTACACAACCATTAACGTCAGACACAAATCCAGACCTGCAGTAATGAGGATTTATTTGAT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1080970 True 223 lncRNA 0.41 1 15518492 15518714
Loading

Neighbor


gene id symbol gene type direction distance location
lnx2a lnx2 coding upstream 331 15497461 ~ 15518161 (+)
urad urad coding upstream 38624 15478585 ~ 15479868 (+)
LOC110535338 LOC106579503 coding upstream 40270 15375660 ~ 15478222 (+)
LOC110536557 LOC106579543 coding upstream 150949 15342361 ~ 15367543 (+)
tmprss7 tmprss7 coding upstream 181302 15320582 ~ 15337190 (+)
usp12a usp12 coding downstream 11461 15530175 ~ 15534688 (+)
LOC110535348 LOC106579510 coding downstream 20964 15539678 ~ 15547074 (+)
rnf6 LOC106579512 coding downstream 68570 15587284 ~ 15593900 (+)
atp8a2 LOC106579514 coding downstream 75702 15594416 ~ 15660363 (+)
spice1 spice1 coding downstream 169546 15688260 ~ 15695114 (+)
G947980 NA non-coding upstream 26862 15491107 ~ 15491630 (+)
G947984 NA non-coding upstream 27981 15490288 ~ 15490511 (+)
G947956 NA non-coding upstream 80874 15436326 ~ 15437618 (+)
G947952 NA non-coding upstream 87612 15430587 ~ 15430880 (+)
G947951 NA non-coding upstream 90108 15427930 ~ 15428384 (+)
G948000 NA non-coding downstream 1750 15520464 ~ 15520678 (+)
G948005 rpl21 non-coding downstream 7723 15526437 ~ 15529942 (+)
G948011 NA non-coding downstream 19451 15538165 ~ 15538443 (+)
G948049 LOC106579518 non-coding downstream 176476 15695190 ~ 15699638 (+)
spata13 LOC106579541 other upstream 219119 15285042 ~ 15320246 (+)
G947301 LOC106590396 other upstream 631210 14886614 ~ 14887282 (+)
LOC110535322 LOC106579526 other upstream 848736 14665667 ~ 14715423 (+)
G946999 NA other upstream 934443 14582543 ~ 14584049 (+)
boc LOC106579445 other downstream 228659 15747150 ~ 15800515 (+)
G948524 NA other downstream 535351 16054065 ~ 16054638 (+)
sh3kbp1 LOC106579452 other downstream 554702 16073315 ~ 16098499 (+)

Expression


G947999 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G947999 Expression in each Bioproject

Bar chart with 6 bars.
G947999 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network