G951340



Basic Information


Item Value
gene id G951340
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 18812408 ~ 18812766 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1084851
cagctgtacatagtctatcggtaaatagcccacccatttttacctacctcatccccatactgtttttatttatttacttttctgctcttttgcacaccagtatctctacctgtgcatgaccatctgatcattcatcactccaatgttaatctgcaaaattgtaattatttgcctacctcctcatgccttttgcacacaatgtatatagactctctttttttttctactgtgttattgacttgttaattgtgtactccatgtgtaactctgtgttgtctgttcacactgctatgctttatcttggccaggtcgcagttgcaaatgagaacttgttctcaactagcctacctggttaaata

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1084851 True 359 lncRNA 0.38 1 18812408 18812766

Neighbor


gene id symbol gene type direction distance location
LOC110535429 nup58 coding upstream 9537 18790170 ~ 18802871 (+)
pex2 pex2 coding upstream 608255 18192624 ~ 18204153 (+)
hnf4g hnf4g coding upstream 830511 17960186 ~ 17981897 (+)
LOC110535422 LOC106578412 coding upstream 852408 17949429 ~ 17960000 (+)
pign pign coding upstream 867204 17926634 ~ 17945204 (+)
ankrd33ba LOC106578420 coding downstream 9568 18822334 ~ 18844891 (+)
LOC110535436 LOC106578460 coding downstream 485813 19298579 ~ 19310732 (+)
LOC110535438 NA coding downstream 517215 19329981 ~ 19335648 (+)
ssm4 ssm4 coding downstream 529215 19341981 ~ 19345685 (+)
LOC110535439 LOC106578454 coding downstream 564369 19377135 ~ 19385929 (+)
G951277 tlr13 non-coding upstream 85315 18717429 ~ 18727093 (+)
G951270 NA non-coding upstream 135380 18649576 ~ 18677028 (+)
G951225 NA non-coding upstream 216916 18562338 ~ 18595492 (+)
G951184 NA non-coding upstream 286089 18526050 ~ 18526319 (+)
G951335 NA non-coding downstream 32590 18845356 ~ 18845789 (+)
G951352 NA non-coding downstream 33406 18846172 ~ 18846434 (+)
G951353 NA non-coding downstream 34205 18846971 ~ 18847197 (+)
G951362 NA non-coding downstream 60085 18872851 ~ 18873196 (+)
G951367 NA non-coding downstream 67966 18880732 ~ 18880991 (+)
G948710 NA other upstream 2210516 16554200 ~ 16601892 (+)
LOC110535387 LOC106579475 other upstream 2267119 16543682 ~ 16565783 (+)
LOC110535372 mynn other upstream 2477116 16327393 ~ 16338373 (+)
G948587 NA other upstream 2486001 16323350 ~ 16326407 (+)
ccl20b LOC100135878 other upstream 2601568 16209929 ~ 16211192 (+)
G951511 NA other downstream 313899 19126665 ~ 19127085 (+)
phldb2b tcpe other downstream 948499 19740565 ~ 19799150 (+)
tlcd4a LOC106570700 other downstream 3913787 22712577 ~ 22741263 (+)
G956728 LOC106613263 other downstream 4852522 23665288 ~ 23665930 (+)
G956797 NA other downstream 4963006 23775772 ~ 23776845 (+)

Expression


G951340 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G951340 Expression in each Bioproject

Bar chart with 18 bars.
G951340 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network