G951367



Basic Information


Item Value
gene id G951367
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 18880732 ~ 18880991 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1084885
GTCAGAGACTCTGATGAAAACATCAGTCTTTAACCTGAGAACATGTCAGAACTTCTGATGAAAACATCAGTCTTTAACCTAAGAACATGTCAGAGACTCTGGTGAAAACAACATCAGCCTTTAACCTGAGAACATGTCAGAACTTCTGATGAAAACATCAGTCTTTAACCTGAGAACATGTCAGAACTTCTGATGAAAACAACATCAGCCTTTAACCTGAGAACATGTCAGAACTTCTGATGAAAACATCAGTCTTTAAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1084885 True 260 lncRNA 0.38 1 18880732 18880991
Loading

Neighbor


gene id symbol gene type direction distance location
ankrd33ba LOC106578420 coding upstream 35841 18822334 ~ 18844891 (+)
LOC110535429 nup58 coding upstream 77861 18790170 ~ 18802871 (+)
pex2 pex2 coding upstream 676579 18192624 ~ 18204153 (+)
hnf4g hnf4g coding upstream 898835 17960186 ~ 17981897 (+)
LOC110535422 LOC106578412 coding upstream 920732 17949429 ~ 17960000 (+)
LOC110535436 LOC106578460 coding downstream 417588 19298579 ~ 19310732 (+)
LOC110535438 NA coding downstream 448990 19329981 ~ 19335648 (+)
ssm4 ssm4 coding downstream 460990 19341981 ~ 19345685 (+)
LOC110535439 LOC106578454 coding downstream 496144 19377135 ~ 19385929 (+)
LOC110535440 LOC106590594 coding downstream 520531 19401522 ~ 19414736 (+)
G951362 NA non-coding upstream 7536 18872851 ~ 18873196 (+)
G951353 NA non-coding upstream 33535 18846971 ~ 18847197 (+)
G951352 NA non-coding upstream 34298 18846172 ~ 18846434 (+)
G951335 NA non-coding upstream 34943 18845356 ~ 18845789 (+)
G951340 NA non-coding upstream 67966 18812408 ~ 18812766 (+)
G951368 NA non-coding downstream 1993 18882984 ~ 18883263 (+)
G951369 NA non-coding downstream 4507 18885498 ~ 18885727 (+)
G951370 NA non-coding downstream 4786 18885777 ~ 18886106 (+)
G951392 NA non-coding downstream 45313 18926304 ~ 18926541 (+)
G951465 NA non-coding downstream 175307 19056298 ~ 19056512 (+)
G948710 NA other upstream 2278840 16554200 ~ 16601892 (+)
LOC110535387 LOC106579475 other upstream 2335443 16543682 ~ 16565783 (+)
LOC110535372 mynn other upstream 2545440 16327393 ~ 16338373 (+)
G948587 NA other upstream 2554325 16323350 ~ 16326407 (+)
ccl20b LOC100135878 other upstream 2669892 16209929 ~ 16211192 (+)
G951511 NA other downstream 245674 19126665 ~ 19127085 (+)
phldb2b tcpe other downstream 880274 19740565 ~ 19799150 (+)
tlcd4a LOC106570700 other downstream 3845562 22712577 ~ 22741263 (+)
G956728 LOC106613263 other downstream 4784297 23665288 ~ 23665930 (+)
G956797 NA other downstream 4894781 23775772 ~ 23776845 (+)

Expression


G951367 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G951367 Expression in each Bioproject

Bar chart with 13 bars.
G951367 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network