G951472



Basic Information


Item Value
gene id G951472
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 19069808 ~ 19070019 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1084994
GAAAAATATTCAGTGTTTGCATTGCATACATGGAGGGATTCACTTTGAGAGGAGCGTCGTTGCACATGTGTGTGTACGTCTTACCTGCCAGACTGCCTGGCCTCTGTAGCGTAGCGGTAGCATAGAGCTCATGGGATATCTTGTACTGGTCGGAGGCGTGGTGAGCAGCCAGTCTTTTAGGAGACAGAGTAGCGTAGCTCCCTATGCCCGAA

Function


NR:

description
catenin delta-2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1084994 True 212 lncRNA 0.51 1 19069808 19070019

Neighbor


gene id symbol gene type direction distance location
ankrd33ba LOC106578420 coding upstream 224917 18822334 ~ 18844891 (+)
LOC110535429 nup58 coding upstream 266937 18790170 ~ 18802871 (+)
pex2 pex2 coding upstream 865655 18192624 ~ 18204153 (+)
hnf4g hnf4g coding upstream 1087911 17960186 ~ 17981897 (+)
LOC110535422 LOC106578412 coding upstream 1109808 17949429 ~ 17960000 (+)
LOC110535436 LOC106578460 coding downstream 228560 19298579 ~ 19310732 (+)
LOC110535438 NA coding downstream 259962 19329981 ~ 19335648 (+)
ssm4 ssm4 coding downstream 271962 19341981 ~ 19345685 (+)
LOC110535439 LOC106578454 coding downstream 307116 19377135 ~ 19385929 (+)
LOC110535440 LOC106590594 coding downstream 331503 19401522 ~ 19414736 (+)
G951468 NA non-coding upstream 6947 19062555 ~ 19062861 (+)
G951465 NA non-coding upstream 13296 19056298 ~ 19056512 (+)
G951392 NA non-coding upstream 143267 18926304 ~ 18926541 (+)
G951370 NA non-coding upstream 183702 18885777 ~ 18886106 (+)
G951369 NA non-coding upstream 184081 18885498 ~ 18885727 (+)
G951473 LOC106578459 non-coding downstream 347 19070366 ~ 19070672 (+)
G951477 NA non-coding downstream 4473 19074492 ~ 19074712 (+)
G951480 NA non-coding downstream 12064 19082083 ~ 19082332 (+)
G951481 NA non-coding downstream 12805 19082824 ~ 19083033 (+)
G951483 NA non-coding downstream 13859 19083878 ~ 19084081 (+)
G948710 NA other upstream 2467916 16554200 ~ 16601892 (+)
LOC110535387 LOC106579475 other upstream 2524519 16543682 ~ 16565783 (+)
LOC110535372 mynn other upstream 2734516 16327393 ~ 16338373 (+)
G948587 NA other upstream 2743401 16323350 ~ 16326407 (+)
ccl20b LOC100135878 other upstream 2858968 16209929 ~ 16211192 (+)
G951511 NA other downstream 56646 19126665 ~ 19127085 (+)
phldb2b tcpe other downstream 691246 19740565 ~ 19799150 (+)
tlcd4a LOC106570700 other downstream 3656534 22712577 ~ 22741263 (+)
G956728 LOC106613263 other downstream 4595269 23665288 ~ 23665930 (+)
G956797 NA other downstream 4705753 23775772 ~ 23776845 (+)

Expression


G951472 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.
End of interactive chart.

G951472 Expression in each Bioproject

Bar chart with 3 bars.
G951472 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2.
End of interactive chart.

Co-expression Network