G975069 (gli3)


Basic Information

Item Value
gene id G975069
gene name gli3
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 37975915 ~ 38010659 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1110491
CCGTCTGCAGGGCTGAGGCCCCTGGCTGCAGAGATCATAGAAAGTGAGGGACTGGAGTGAAGTGAGCGGATGTAGTCCATGTAGGGGTTGATGTAGGGATGTGGTGGGTTAAAGGGTGACTCGGCCCCCACGGAGGGGTTCCGGTGGGGCGAGATCCGGATGAGGGAGATGTCGGAGAACGCCGGACTGCCGGCCAGCGAAGGAGGCCTACACAGAACGTGTAGAGGGGGAACGGGGGACGGCTCGTAGATGTAGCGACCCTGGGCATGTCTGTCGTCGATGGGCACCGGTGGATGGAAAGCAG

Function

symbol description
gli3 Enables DNA-binding transcription factor activity, RNA polymerase II-specific. Involved in negative regulation of transcription by RNA polymerase II. Acts upstream of or within regulation of neurogenesis. Located in chromatin. Is expressed in several structures, including brain; ceratohyal cartilage; hindbrain neural tube; neural keel; and neural rod. Human ortholog(s) of this gene implicated in Greig cephalopolysyndactyly syndrome; Pallister-Hall syndrome; anodontia; polydactyly; and syndactyly. Orthologous to human GLI3 (GLI family zinc finger 3).

NR:

description
transcriptional activator GLI3 isoform X3

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1110491 True 304 lncRNA 0.62 2 37975915 38010659

Neighbor

gene id symbol gene type direction distance location
LOC118937483 NA coding downstream 112005 37863763 ~ 37863910 (-)
LOC110535662 LOC106595913 coding downstream 159368 37813584 ~ 37816547 (-)
LOC110535661 LOC106578659 coding downstream 166163 37735411 ~ 37809752 (-)
LOC118937348 NA coding downstream 240694 37721569 ~ 37735221 (-)
LOC118937347 LOC106578660 coding downstream 256200 37711188 ~ 37719715 (-)
LOC110535666 LOC106578727 coding upstream 73254 38083913 ~ 38103834 (-)
LOC110535667 LOC106578728 coding upstream 108028 38118687 ~ 38132691 (-)
LOC110535668 LOC106578729 coding upstream 160359 38171018 ~ 38199082 (-)
LOC110536620 NA coding upstream 604541 38615200 ~ 38625390 (-)
LOC110535675 LOC106580203 coding upstream 837298 38847957 ~ 38858323 (-)
G974977 NA non-coding downstream 176985 37798265 ~ 37798930 (-)
LOC110535660 LOC106578660 non-coding downstream 265199 37601439 ~ 37711124 (-)
G974854 NA non-coding downstream 330075 37576457 ~ 37645840 (-)
G974845 NA non-coding downstream 416757 37558865 ~ 37559158 (-)
G974844 NA non-coding downstream 417732 37557982 ~ 37558183 (-)
G975103 LOC106578726 non-coding upstream 34376 38041406 ~ 38045662 (-)
G975109 NA non-coding upstream 66195 38076854 ~ 38077083 (-)
G975139 NA non-coding upstream 126840 38137499 ~ 38137904 (-)
G975146 NA non-coding upstream 133761 38144420 ~ 38144770 (-)
G975167 NA non-coding upstream 188550 38199209 ~ 38199472 (-)
G974756 NA other downstream 560280 37414378 ~ 37415635 (-)
G974622 LOC106578671 other downstream 761019 37213884 ~ 37214896 (-)
G972383 LOC106578698 other downstream 2102657 35872669 ~ 35873258 (-)
G971137 NA other downstream 3136989 34836972 ~ 34838926 (-)
G975110 NA other upstream 67192 38077851 ~ 38078527 (-)
G979041 NA other upstream 3262430 41273089 ~ 41273427 (-)
G980514 NA other upstream 4463151 42473810 ~ 42563730 (-)
kiaa0825 kiaa0825 other upstream 4562602 42425475 ~ 42591782 (-)

Expression


Co-expression Network