G976060 (smad4)


Basic Information

Item Value
gene id G976060
gene name smad4
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 39154164 ~ 39155730 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1111606
GCGATGCCTCCCACGGAGCCCGGCCCAGAAATGTTCCCAGCAATAGAGGCAGCCTGAGCTGCGGCTGCCGCCTGCGCCGTCGCTGCCTGCTGCTGCATTTGCCTGTGGCACTGATGCAGGTCAAACACCTTGATGTAGGCGCTGGGGTAGATCTTGTGCACGGCGTCGCCGGGGGCACGGCCGGCTTCCCTGTCCAGGTAGTAGCTCTGTACAAACACTGCGTGGTCGCTATGGCAACGAACCCACACATCCCCTTCACCTTTGCACTCCAGCTGGATTCCCTTCCCG

Function

symbol description
smad4 Enables several functions, including DNA-binding transcription activator activity, RNA polymerase II-specific; SMAD binding activity; and protein homodimerization activity. Contributes to DNA-binding transcription factor activity and sequence-specific DNA binding activity. Involved in several processes, including positive regulation of transmembrane receptor protein serine/threonine kinase signaling pathway; regulation of gene expression; and transmembrane receptor protein serine/threonine kinase signaling pathway. Located in several cellular components, including centrosome; chromatin; and nucleoplasm. Part of SMAD protein complex and activin responsive factor complex. Implicated in several diseases, including female reproductive organ cancer (multiple); hereditary hemorrhagic telangiectasia; juvenile polyposis syndrome; juvenile polyposis-hereditary hemorrhagic telangiectasia syndrome; and seminoma. Biomarker of several diseases, including carcinoma (multiple); colorectal adenoma; female reproductive organ cancer (multiple); non-alcoholic steatohepatitis; and prostate carcinoma in situ.

NR:

description
Smad4a, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1111606 True 288 lncRNA 0.63 2 39154164 39155730

Neighbor

gene id symbol gene type direction distance location
LOC110535680 LOC106580198 coding upstream 149578 38989854 ~ 39004586 (+)
LOC110535679 LOC106580199 coding upstream 199811 38951292 ~ 38954353 (+)
LOC118937441 NA coding upstream 314104 38838167 ~ 38840060 (+)
LOC118937440 NA coding upstream 319188 38833162 ~ 38834976 (+)
LOC110535673 enkur coding upstream 522461 38626261 ~ 38631703 (+)
LOC110535681 mapkapk5 coding downstream 44006 39199736 ~ 39237016 (+)
LOC110535687 LOC106580186 coding downstream 326765 39482495 ~ 39520766 (+)
LOC110535016 NA coding downstream 471239 39626969 ~ 39633152 (+)
LOC118937442 NA coding downstream 499901 39655631 ~ 39656997 (+)
LOC118937443 NA coding downstream 501880 39657610 ~ 39660250 (+)
G976101 NA non-coding upstream 8467 39145227 ~ 39145697 (+)
G976100 NA non-coding upstream 9311 39144553 ~ 39144853 (+)
G976090 NA non-coding upstream 27167 39126675 ~ 39126997 (+)
G976085 NA non-coding upstream 33984 39119956 ~ 39120180 (+)
G976078 NA non-coding upstream 43547 39110416 ~ 39110617 (+)
G976106 NA non-coding downstream 16548 39172278 ~ 39172510 (+)
G976066 NA non-coding downstream 68216 39223946 ~ 39224300 (+)
G976064 NA non-coding downstream 69526 39225256 ~ 39225849 (+)
G976062 NA non-coding downstream 71534 39227264 ~ 39227840 (+)
G976065 NA non-coding downstream 73945 39229675 ~ 39231437 (+)
G976017 NA other upstream 96153 39057676 ~ 39058011 (+)
G974184 NA other upstream 1091064 38057798 ~ 38063100 (+)
LOC110535015 LOC106578726 other upstream 1110834 37866715 ~ 38045713 (+)
lztfl1 LOC106590188 other upstream 1318829 37813177 ~ 37835340 (+)
G973918 NA other upstream 1474796 37651138 ~ 37679368 (+)
G978255 NA other downstream 1612106 40767836 ~ 40768229 (+)
G978396 NA other downstream 1847346 41003076 ~ 41016088 (+)
G979689 NA other downstream 2922762 42078492 ~ 42078855 (+)
G979965 NA other downstream 3372790 42528520 ~ 42533308 (+)
G980019 NA other downstream 3476094 42631824 ~ 42636709 (+)

Expression


Co-expression Network