G982870



Basic Information


Item Value
gene id G982870
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 44623896 ~ 44624183 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1118877
AGGGAGAAAGGACTTATCTAGAAAGTCTGATTTTCTAGGAGACTTCTAAAACACATGGAGGAATAGAGACCGCAGCAGTTCAACAACCAGGACAAAAGAAAGATGTGTGAGGGGTGGGGGTTGGAAGGTGGTATTGCGGGTCACAGGCTTTGGCAGCACGGTAGTTTGTTTTTCTGCCCATCGGTGGTGGGGGGGACACAGATATCCACTACATTGTTGCCTGGAGACTCGTCATGTGCTGATCTGTCAGCTATCTGCTTCTGTGATACGATTCGGTGGATTTCTGTG
>TU1118878
AGGGAGAAAGGACTTATCTAGAAAGTCTGATTTTCTAGGAGACTTCTAAAACACATGGAGGAATAGAGACCGCAGCAGTTCAACAACCAGGACAAAAGAAAGATGTGTGAGGGGTGGGGGTTGGAAGGTGGTATTGCGGGTCACAGGCTTTGGCAGCACGGTAGTTTGTTTTTCTGCCCATCGGTGGTGGGGGGGACACAGATATCCACTACATTGTTG

Function


NR:

description
ras-related protein Rab-11B-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1118877 False 288 lncRNA 0.49 1 44623896 44624183
TU1118878 True 219 lncRNA 0.48 1 44623965 44624183
Loading

Neighbor


gene id symbol gene type direction distance location
mef2cb LOC106580134 coding downstream 97894 44425190 ~ 44526002 (-)
LOC110535727 NA coding downstream 204973 44346207 ~ 44418923 (-)
LOC110535726 LOC106580137 coding downstream 304194 44284283 ~ 44319702 (-)
ccnh ccnh coding downstream 440696 44175382 ~ 44183200 (-)
LOC110535721 NA coding downstream 504729 44106462 ~ 44119167 (-)
LOC118937358 NA coding upstream 471914 45096097 ~ 45098089 (-)
LOC110535733 LOC106580130 coding upstream 478296 45102479 ~ 45127262 (-)
LOC110536624 NA coding upstream 562299 45186482 ~ 45188376 (-)
LOC110535738 ntng2 coding upstream 1002536 45626719 ~ 45685891 (-)
LOC110535743 card9 coding upstream 1292411 45916594 ~ 45922287 (-)
G982760 NA non-coding downstream 53445 44570173 ~ 44570451 (-)
G982755 NA non-coding downstream 57575 44565986 ~ 44566321 (-)
G982666 NA non-coding downstream 188982 44433144 ~ 44434914 (-)
G982566 NA non-coding downstream 387481 44236206 ~ 44236415 (-)
G982891 NA non-coding upstream 29588 44653771 ~ 44654091 (-)
G982899 NA non-coding upstream 45887 44670070 ~ 44670641 (-)
G982955 NA non-coding upstream 81895 44706078 ~ 44706298 (-)
G983190 NA non-coding upstream 257595 44881778 ~ 44882090 (-)
G983195 NA non-coding upstream 259204 44883387 ~ 44883695 (-)
G982818 LOC106613263 other downstream 13954 44609409 ~ 44609942 (-)
LOC110535714 LOC106580145 other downstream 1987834 42631822 ~ 42836577 (-)
kiaa0825 kiaa0825 other downstream 2032128 42425475 ~ 42591782 (-)
G980514 NA other downstream 2060166 42473810 ~ 42563730 (-)
G979041 NA other downstream 3350469 41273089 ~ 41273427 (-)
G983486 NA other upstream 475305 45099488 ~ 45100219 (-)
G984166 LOC106580127 other upstream 981541 45605724 ~ 45606417 (-)
LOC110535758 foxn4 other upstream 1578526 46202709 ~ 46223082 (-)
G985191 fam222a other upstream 1915350 46539533 ~ 46541987 (-)
gltpa gltp other upstream 1968173 46592176 ~ 46602166 (-)

Expression


G982870 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G982870 Expression in each Bioproject

Bar chart with 13 bars.
G982870 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network