G984166 (LOC106580127)



Basic Information


Item Value
gene id G984166
gene name LOC106580127
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 45605724 ~ 45606417 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1120247
TGAAAAGGACTGATTTCCGGTAGCTCTGCTTGCGGAAAGTAGCGAGTTGCCATTAGAGAGGTTGCCATTAGAGAGTAAATCAAAGTAGTGCGGTGTAATCCTGGTACCTGGTCCAGCTGAGAGACTGCCTCGGCCAGCAGGGAGTGCAGGGTGGAGAGCTCGCGGCCCAGGTCGATGTAACCCTCGAACCCTGCCGTGTTGGAGATGGTCTCTGGGTTGGAGATCTCCAGCAGGAAGCGCTGCATGTTGGTCCACTCGTGCTCCAGGAAGTGGTTCATAAAGGACATGTACTCCTCCTTGTTACCAAACCTGGACAGATTGGTGAAGTTGGCGAGGTTCTGTGTGACCTTGGCGATGAGGGTGAGGGTTCGCGCGGTGCGGTCGTCTGGGTACTCCTGCATCAGGTTGAAAAGCGACGGGGACATGACGGCCGGACACAGGAAGCGCAGGAACAGGGAGGCGCTGATAAGACGCTCGCTGATGTCCGGCCGGCCCCGACTGCTGCACTCCTGCCTCCACGAGGCAAACACCTCTTTCAG

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1120247 True 539 TUCP 0.57 2 45605724 45606417

Neighbor


gene id symbol gene type direction distance location
LOC110536624 NA coding downstream 417348 45186482 ~ 45188376 (-)
LOC110535733 LOC106580130 coding downstream 478462 45102479 ~ 45127262 (-)
LOC118937358 NA coding downstream 507635 45096097 ~ 45098089 (-)
mef2cb LOC106580134 coding downstream 1079722 44425190 ~ 44526002 (-)
LOC110535727 NA coding downstream 1186801 44346207 ~ 44418923 (-)
LOC110535738 ntng2 coding upstream 20302 45626719 ~ 45685891 (-)
LOC110535743 card9 coding upstream 310177 45916594 ~ 45922287 (-)
LOC110535744 LOC106580121 coding upstream 317057 45923474 ~ 45942406 (-)
entr1 LOC106580119 coding upstream 346448 45952865 ~ 45957700 (-)
gstt2 LOC106580120 coding upstream 360180 45966597 ~ 45969187 (-)
G984165 NA non-coding downstream 236 45605281 ~ 45605488 (-)
G984164 NA non-coding downstream 658 45604722 ~ 45605066 (-)
G984163 NA non-coding downstream 1103 45604358 ~ 45604621 (-)
G984162 NA non-coding downstream 1871 45603652 ~ 45603853 (-)
G984159 NA non-coding downstream 7312 45598082 ~ 45598412 (-)
G984167 NA non-coding upstream 100 45606517 ~ 45606770 (-)
G984175 NA non-coding upstream 9975 45616392 ~ 45618414 (-)
G984181 NA non-coding upstream 16922 45623339 ~ 45624027 (-)
G984602 NA non-coding upstream 80599 45687016 ~ 45699573 (-)
G984737 NA non-coding upstream 258695 45865112 ~ 45866750 (-)
G983486 NA other downstream 505505 45099488 ~ 45100219 (-)
G982818 LOC106613263 other downstream 995782 44609409 ~ 44609942 (-)
LOC110535714 LOC106580145 other downstream 2969662 42631822 ~ 42836577 (-)
kiaa0825 kiaa0825 other downstream 3013956 42425475 ~ 42591782 (-)
G980514 NA other downstream 3041994 42473810 ~ 42563730 (-)
LOC110535758 foxn4 other upstream 596292 46202709 ~ 46223082 (-)
G985191 fam222a other upstream 933116 46539533 ~ 46541987 (-)
gltpa gltp other upstream 985939 46592176 ~ 46602166 (-)
G985626 NA other upstream 1039911 46646328 ~ 46646949 (-)
G985699 LOC106613263 other upstream 1188202 46793282 ~ 46801092 (-)

Expression


G984166(LOC106580127) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.2.
End of interactive chart.

G984166(LOC106580127) Expression in each Bioproject

Bar chart with 5 bars.
G984166(LOC106580127) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 2.
End of interactive chart.

Co-expression Network