G984602



Basic Information


Item Value
gene id G984602
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 45687016 ~ 45699573 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1120785
GTTAGACCACTTGTATGCCTGAAGGAGCTGACTGTACAGCGGGGTCTTGTCCTGAACTGGGTCCAGACTCAACAGGCCACTGTTGTGAAGGGGATGACTCTCTGAAGGTCTGCCAACCAGGGTACTGAGGCGTTCCAATTCATTCAGAGAGTCAAAAACCCTTGTTACACTTGAACGAAGTGCCTGAATAGCACTTATTGCTTGAGAAAATGCTTCTAAATTCACACCAACGTTCATTGCGTCCGCCATTTTTTT

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1120785 True 255 lncRNA 0.47 2 45687016 45699573
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110535738 ntng2 coding downstream 1125 45626719 ~ 45685891 (-)
LOC110536624 NA coding downstream 498640 45186482 ~ 45188376 (-)
LOC110535733 LOC106580130 coding downstream 559754 45102479 ~ 45127262 (-)
LOC118937358 NA coding downstream 588927 45096097 ~ 45098089 (-)
mef2cb LOC106580134 coding downstream 1161014 44425190 ~ 44526002 (-)
LOC110535743 card9 coding upstream 217021 45916594 ~ 45922287 (-)
LOC110535744 LOC106580121 coding upstream 223901 45923474 ~ 45942406 (-)
entr1 LOC106580119 coding upstream 253292 45952865 ~ 45957700 (-)
gstt2 LOC106580120 coding upstream 267024 45966597 ~ 45969187 (-)
LOC110535747 LOC106580117 coding upstream 273482 45973055 ~ 45990422 (-)
G984181 NA non-coding downstream 62989 45623339 ~ 45624027 (-)
G984175 NA non-coding downstream 68602 45616392 ~ 45618414 (-)
G984167 NA non-coding downstream 80246 45606517 ~ 45606770 (-)
G984165 NA non-coding downstream 81528 45605281 ~ 45605488 (-)
G984164 NA non-coding downstream 81950 45604722 ~ 45605066 (-)
G984737 NA non-coding upstream 165539 45865112 ~ 45866750 (-)
G984742 NA non-coding upstream 170437 45870010 ~ 45870223 (-)
G984809 NA non-coding upstream 311179 46010752 ~ 46012725 (-)
G984856 NA non-coding upstream 423272 46122845 ~ 46124545 (-)
G984858 NA non-coding upstream 427853 46127426 ~ 46127647 (-)
G984166 LOC106580127 other downstream 80599 45605724 ~ 45606417 (-)
G983486 NA other downstream 586797 45099488 ~ 45100219 (-)
G982818 LOC106613263 other downstream 1077074 44609409 ~ 44609942 (-)
LOC110535714 LOC106580145 other downstream 3050954 42631822 ~ 42836577 (-)
kiaa0825 kiaa0825 other downstream 3095248 42425475 ~ 42591782 (-)
LOC110535758 foxn4 other upstream 503136 46202709 ~ 46223082 (-)
G985191 fam222a other upstream 839960 46539533 ~ 46541987 (-)
gltpa gltp other upstream 892783 46592176 ~ 46602166 (-)
G985626 NA other upstream 946755 46646328 ~ 46646949 (-)
G985699 LOC106613263 other upstream 1095046 46793282 ~ 46801092 (-)

Expression


G984602 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.5.
End of interactive chart.

G984602 Expression in each Bioproject

Bar chart with 5 bars.
G984602 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 4.
End of interactive chart.

Co-expression Network