G984908



Basic Information


Item Value
gene id G984908
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 46225478 ~ 46225685 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1121172
GGACAGACAGGGGTGTTTTGGGAAACACTTAGGTGCAAGACAAAAACAGAGCCACCAAACACTGGTTGTTGCTTCTTTTAGAGAGGGAATCCCGTTGTTCCCCCCATTATTCCTGAGAGAGCGGAATGTCATCACTGTGTTCACTGAACCGCAGGGAGTCGTTTACTGGGACTTCCTTGACTGATGCAAACAGTGGTGACAGTACTTG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1121172 True 208 lncRNA 0.49 1 46225478 46225685
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110535758 foxn4 coding downstream 2396 46202709 ~ 46223082 (-)
pole pole coding downstream 52870 46135626 ~ 46172608 (-)
pes pesc coding downstream 98993 46107907 ~ 46126485 (-)
gal3st1a LOC106580113 coding downstream 119670 46085454 ~ 46105808 (-)
lztr1 lztr1 coding downstream 144723 46067991 ~ 46080755 (-)
LOC110535030 kctd10 coding upstream 54511 46280196 ~ 46286223 (-)
mmab mmab coding upstream 105557 46331242 ~ 46335481 (-)
LOC110535765 trpv4 coding upstream 337896 46563581 ~ 46586735 (-)
gltpa gltp coding upstream 366491 46592176 ~ 46602166 (-)
LOC110535767 git2 coding upstream 384431 46610116 ~ 46645542 (-)
G984893 NA non-coding downstream 30745 46194183 ~ 46194733 (-)
G984859 LOC106580269 non-coding downstream 92420 46128001 ~ 46133058 (-)
G984858 NA non-coding downstream 97831 46127426 ~ 46127647 (-)
G984856 NA non-coding downstream 100933 46122845 ~ 46124545 (-)
G984909 NA non-coding upstream 3547 46229232 ~ 46229432 (-)
G984911 NA non-coding upstream 4647 46230332 ~ 46230552 (-)
G984919 NA non-coding upstream 17183 46242868 ~ 46243577 (-)
G984946 NA non-coding upstream 62028 46287713 ~ 46287987 (-)
G984166 LOC106580127 other downstream 619061 45605724 ~ 45606417 (-)
G983486 NA other downstream 1125259 45099488 ~ 45100219 (-)
G982818 LOC106613263 other downstream 1615536 44609409 ~ 44609942 (-)
LOC110535714 LOC106580145 other downstream 3589416 42631822 ~ 42836577 (-)
G985191 fam222a other upstream 313848 46539533 ~ 46541987 (-)
G985626 NA other upstream 420643 46646328 ~ 46646949 (-)
G985699 LOC106613263 other upstream 568934 46793282 ~ 46801092 (-)
G985835 NA other upstream 833698 47059383 ~ 47060663 (-)

Expression


G984908 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G984908 Expression in each Bioproject

Bar chart with 4 bars.
G984908 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.

Co-expression Network