G1001963



Basic Information


Item Value
gene id G1001963
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 62038991 ~ 62039240 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1140111
ttgttaatgttgtaaatgactatttagctggaaatggctttctttttaatggaatatctacagttgaagtcggaagtttacatacatcgtagccaaatacagtggggcaaaaaaagtagttagtcagccaccaattgtgcaagttctcccacttaaaaagatgagaggcctgtaattttcatcagaggtacacttcaactatgacagacaaaatgagaaaaaaaatccagaaaatcacattgtaggattt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1140111 True 250 lncRNA 0.35 1 62038991 62039240

Neighbor


gene id symbol gene type direction distance location
f2r LOC106580418 coding upstream 9435 62025867 ~ 62029556 (+)
LOC110536173 LOC106580416 coding upstream 13350 61924355 ~ 62025641 (+)
LOC110536172 LOC106580415 coding upstream 122690 61838597 ~ 61916301 (+)
LOC110536170 LOC106580413 coding upstream 222676 61801041 ~ 61816315 (+)
LOC110536169 LOC106580482 coding upstream 237169 61787232 ~ 61802788 (+)
LOC110536179 LOC106580421 coding downstream 178791 62218031 ~ 62226942 (+)
ikbkb ikbkb coding downstream 370378 62409618 ~ 62444852 (+)
enkd1 enkd1 coding downstream 433571 62472811 ~ 62476981 (+)
LOC110535089 polb coding downstream 440292 62479532 ~ 62485088 (+)
LOC110536190 LOC103397138 coding downstream 451675 62490915 ~ 62494341 (+)
G1001923 NA non-coding upstream 118556 61920224 ~ 61920435 (+)
G1001872 NA non-coding upstream 120420 61917786 ~ 61918571 (+)
G1001917 NA non-coding upstream 137350 61901341 ~ 61901641 (+)
G1001865 LOC100380853 non-coding upstream 212697 61825987 ~ 61826294 (+)
G1001965 NA non-coding downstream 1408 62040648 ~ 62040879 (+)
G1001968 NA non-coding downstream 6652 62045892 ~ 62046203 (+)
G1001839 NA non-coding downstream 7506 62046746 ~ 62046881 (+)
G1001838 NA non-coding downstream 7863 62047103 ~ 62051505 (+)
G1002006 NA non-coding downstream 71843 62111083 ~ 62140719 (+)
LOC110535084 lnpep other upstream 842914 61180837 ~ 61206347 (+)
LOC110536086 LOC106580340 other upstream 2667153 59363887 ~ 59371838 (+)
G998557 LOC106588150 other upstream 3736004 58301585 ~ 58302987 (+)
G997824 NA other upstream 4249820 57787468 ~ 57789171 (+)
G1002117 NA other downstream 261937 62301177 ~ 62302835 (+)
G1004025 LOC106580455 other downstream 1516725 63555965 ~ 63558816 (+)
G1004271 NA other downstream 1595914 63635154 ~ 63636247 (+)
fbrsl1 LOC106580457 other downstream 1982622 64021862 ~ 64363785 (+)

Expression


G1001963 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1001963 Expression in each Bioproject

Bar chart with 13 bars.
G1001963 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network