G1003509



Basic Information


Item Value
gene id G1003509
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 63022040 ~ 63022267 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1141839
agagtgccaaatccaattacagaaatgctcattataaaaattcagaaaacaaaacatattttacataggtttaaagattaacttcttgttaaaccaaccacagtgtcatatttataaaatgcttttcggtgaaagcatacctagcccagaacatacctagcccagaacatagcccagttgacaaattattacaaacagtaaccagccaagcagaagcgttacaaaact

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1141839 True 228 lncRNA 0.34 1 63022040 63022267

Neighbor


gene id symbol gene type direction distance location
LOC118937456 NA coding downstream 13944 63006679 ~ 63008096 (-)
gpat2 LOC106580447 coding downstream 35603 62935274 ~ 62986437 (-)
zgc:152830 LOC106580446 coding downstream 94557 62920442 ~ 62927483 (-)
LOC110536211 pcna coding downstream 102239 62916347 ~ 62919801 (-)
LOC110536207 LOC106580444 coding downstream 142166 62804837 ~ 62879874 (-)
adra2b LOC106580448 coding upstream 224260 63246527 ~ 63253768 (-)
dusp2 LOC106580476 coding upstream 246358 63268625 ~ 63272680 (-)
LOC110535091 izumo1 coding upstream 253720 63275987 ~ 63278272 (-)
idua idua coding upstream 281669 63303936 ~ 63316827 (-)
LOC110536219 LOC106580453 coding upstream 297747 63320014 ~ 63347508 (-)
G1003498 NA non-coding downstream 28993 62992815 ~ 62993047 (-)
G1003496 NA non-coding downstream 33530 62988244 ~ 62988510 (-)
G1003495 NA non-coding downstream 33799 62988037 ~ 62988241 (-)
G1003400 NA non-coding downstream 312885 62704461 ~ 62709155 (-)
G1003398 LOC106580440 non-coding downstream 320122 62701616 ~ 62701918 (-)
G1003575 NA non-coding upstream 44346 63066613 ~ 63066818 (-)
G1003583 NA non-coding upstream 48273 63070540 ~ 63070754 (-)
G1003592 NA non-coding upstream 54990 63077257 ~ 63077488 (-)
G1003936 NA non-coding upstream 277806 63300073 ~ 63300415 (-)
G1003948 NA non-coding upstream 346393 63368660 ~ 63374498 (-)
LOC110536206 LOC106580443 other downstream 275792 62740236 ~ 62804200 (-)
LOC110536201 LOC106580439 other downstream 332718 62663428 ~ 62689389 (-)
LOC110536162 NA other downstream 1380609 61636026 ~ 61657316 (-)
mrps36 LOC106580406 other downstream 1426630 61592425 ~ 61595436 (-)
LOC110535085 setbp1 other downstream 1690833 61269833 ~ 61331394 (-)
G1004487 NA other upstream 779262 63801529 ~ 63802002 (-)
G1005628 LOC106580457 other upstream 1338497 64360764 ~ 64363777 (-)
G1006106 NA other upstream 2076693 65098960 ~ 65099556 (-)
G1007506 NA other upstream 3350375 66372642 ~ 66372949 (-)
G1009720 NA other upstream 4948804 67971071 ~ 67971328 (-)

Expression


G1003509 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1003509 Expression in each Bioproject

Bar chart with 20 bars.
G1003509 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network