G1003936



Basic Information


Item Value
gene id G1003936
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 63300073 ~ 63300415 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1142302
CATTTATTTATCAAGTAGTATGTATGACATTGTCATGAGGGTGTGTAACAAGGGTACAAACATTTAACTTTACTTACAATACTGCATTTATTTTATATGCCATGTAAATGACTACAAAAAAATAGATTTGGTCTCCAGACCAAGTGAGGGTTTATCGGTTAGAGTGCACACGTCAGTAAAATAACTGTGCTGGAGAGTTTTGGACCAAGTATATCCAGGAAAATAAGAGTGGAAAAATACAGGAGCAGTGTGAAGAGCTTCACAGTAACTTCTCCCAGTGCCAGCTCATTTCAAAATCGACTCTTCAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1142302 True 308 lncRNA 0.37 2 63300073 63300415
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110535091 izumo1 coding downstream 21801 63275987 ~ 63278272 (-)
dusp2 LOC106580476 coding downstream 27393 63268625 ~ 63272680 (-)
adra2b LOC106580448 coding downstream 46305 63246527 ~ 63253768 (-)
LOC118937456 NA coding downstream 291977 63006679 ~ 63008096 (-)
gpat2 LOC106580447 coding downstream 313636 62935274 ~ 62986437 (-)
idua idua coding upstream 3521 63303936 ~ 63316827 (-)
LOC110536219 LOC106580453 coding upstream 19599 63320014 ~ 63347508 (-)
LOC110535092 NA coding upstream 74485 63374900 ~ 63408164 (-)
atad1a LOC106580455 coding upstream 252498 63552161 ~ 63559008 (-)
LOC110536222 LOC106580456 coding upstream 328097 63628512 ~ 63758420 (-)
G1003592 NA non-coding downstream 222585 63077257 ~ 63077488 (-)
G1003583 NA non-coding downstream 229319 63070540 ~ 63070754 (-)
G1003575 NA non-coding downstream 233255 63066613 ~ 63066818 (-)
G1003509 NA non-coding downstream 277806 63022040 ~ 63022267 (-)
G1003498 NA non-coding downstream 307026 62992815 ~ 62993047 (-)
G1003948 NA non-coding upstream 68245 63368660 ~ 63374498 (-)
G1003964 NA non-coding upstream 97514 63397929 ~ 63398343 (-)
G1004093 NA non-coding upstream 117296 63417711 ~ 63417991 (-)
G1004135 NA non-coding upstream 172975 63473390 ~ 63480308 (-)
G1004147 NA non-coding upstream 186801 63487216 ~ 63487479 (-)
LOC110536206 LOC106580443 other downstream 553825 62740236 ~ 62804200 (-)
LOC110536201 LOC106580439 other downstream 610751 62663428 ~ 62689389 (-)
LOC110536162 NA other downstream 1658642 61636026 ~ 61657316 (-)
mrps36 LOC106580406 other downstream 1704663 61592425 ~ 61595436 (-)
LOC110535085 setbp1 other downstream 1968866 61269833 ~ 61331394 (-)
G1004487 NA other upstream 501114 63801529 ~ 63802002 (-)
G1005628 LOC106580457 other upstream 1060349 64360764 ~ 64363777 (-)
G1006106 NA other upstream 1798545 65098960 ~ 65099556 (-)
G1007506 NA other upstream 3072227 66372642 ~ 66372949 (-)
G1009720 NA other upstream 4670656 67971071 ~ 67971328 (-)

Expression


G1003936 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 80.
End of interactive chart.

G1003936 Expression in each Bioproject

Bar chart with 9 bars.
G1003936 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network