G1004135



Basic Information


Item Value
gene id G1004135
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 63473390 ~ 63480308 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1142518
gtttaaagcttgggaaatctttttgtatccaaatccggctttaatcttcttcacaacagtatctcggacctgcctggtgtgttccttgttcttcatgatgctctctgcgcttttaacggacctctgagactatcacagtgcaggtgcatttatacggagacttgattacacacaggtggattgtatttatcatcattagtcatttaggtcaac

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1142518 True 213 lncRNA 0.41 2 63473390 63480308
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110535092 NA coding downstream 65226 63374900 ~ 63408164 (-)
LOC110536219 LOC106580453 coding downstream 125882 63320014 ~ 63347508 (-)
idua idua coding downstream 156563 63303936 ~ 63316827 (-)
LOC110535091 izumo1 coding downstream 195118 63275987 ~ 63278272 (-)
dusp2 LOC106580476 coding downstream 200710 63268625 ~ 63272680 (-)
atad1a LOC106580455 coding upstream 72605 63552161 ~ 63559008 (-)
LOC110536222 LOC106580456 coding upstream 148204 63628512 ~ 63758420 (-)
LOC110536227 LOC106580460 coding upstream 967854 64448162 ~ 64472943 (-)
LOC110536230 LOC106580464 coding upstream 1029050 64509358 ~ 64516328 (-)
LOC110536235 LOC106580467 coding upstream 1155911 64636219 ~ 64642155 (-)
G1004093 NA non-coding downstream 55399 63417711 ~ 63417991 (-)
G1003964 NA non-coding downstream 75047 63397929 ~ 63398343 (-)
G1003948 NA non-coding downstream 98892 63368660 ~ 63374498 (-)
G1003936 NA non-coding downstream 172975 63300073 ~ 63300415 (-)
G1003592 NA non-coding downstream 395902 63077257 ~ 63077488 (-)
G1004147 NA non-coding upstream 6908 63487216 ~ 63487479 (-)
G1004153 NA non-coding upstream 18429 63498737 ~ 63499072 (-)
G1004155 NA non-coding upstream 21977 63502285 ~ 63502504 (-)
G1004157 NA non-coding upstream 24945 63505253 ~ 63505521 (-)
G1004158 NA non-coding upstream 25806 63506114 ~ 63506330 (-)
LOC110536206 LOC106580443 other downstream 727142 62740236 ~ 62804200 (-)
LOC110536201 LOC106580439 other downstream 784068 62663428 ~ 62689389 (-)
LOC110536162 NA other downstream 1831959 61636026 ~ 61657316 (-)
mrps36 LOC106580406 other downstream 1877980 61592425 ~ 61595436 (-)
LOC110535085 setbp1 other downstream 2142183 61269833 ~ 61331394 (-)
G1004487 NA other upstream 321221 63801529 ~ 63802002 (-)
G1005628 LOC106580457 other upstream 880456 64360764 ~ 64363777 (-)
G1006106 NA other upstream 1618652 65098960 ~ 65099556 (-)
G1007506 NA other upstream 2892334 66372642 ~ 66372949 (-)
G1009720 NA other upstream 4490763 67971071 ~ 67971328 (-)

Expression


G1004135 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G1004135 Expression in each Bioproject

Bar chart with 19 bars.
G1004135 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network