G1009170



Basic Information


Item Value
gene id G1009170
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 67974953 ~ 67975308 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1147974
aaattcggcctgctaactgctagcttgtttagcccggtccgctaactgctaccgtgtttagcaccgtctactaactgttagcttgttagcacaggccttctaaccatctgaatcgccgcgtcccaaaaactcactgaacccatatttactttctatcccttttcgattttttatttgtttataccttccggtaacctgcctcacccaatgtgatacggaaccgctattatctttacatttttagaactcactcaagaaccttcagaagctaaccagctaactggctacaagctatttagtcattgttagttttctaacctggataacactcgccagtccagcttccctgccccatc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1147974 True 356 lncRNA 0.44 1 67974953 67975308
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110535097 LOC106580544 coding upstream 502174 67453635 ~ 67472779 (+)
LOC110536274 LOC106580519 coding upstream 927426 67046528 ~ 67047527 (+)
LOC110536272 LOC106580517 coding upstream 984554 66946456 ~ 66990399 (+)
LOC110536271 vp37b coding upstream 1030847 66915989 ~ 66944106 (+)
LOC110536270 LOC106580516 coding upstream 1059014 66896753 ~ 66915939 (+)
LOC110536283 LOC106580527 coding downstream 65745 68041053 ~ 68047964 (+)
LOC110536285 LOC106580528 coding downstream 88840 68064148 ~ 68073099 (+)
LOC118937378 NA coding downstream 123817 68099125 ~ 68101800 (+)
LOC110536289 LOC106580533 coding downstream 311750 68287058 ~ 68361204 (+)
LOC110535098 LOC106580534 coding downstream 389172 68364480 ~ 68413213 (+)
G1009168 NA non-coding upstream 2938 67971765 ~ 67972015 (+)
G1009167 NA non-coding upstream 6685 67968034 ~ 67968268 (+)
G1009165 NA non-coding upstream 10226 67964524 ~ 67964727 (+)
G1009090 NA non-coding upstream 59482 67863923 ~ 67915471 (+)
G1009068 NA non-coding upstream 136140 67838521 ~ 67838813 (+)
G1009186 NA non-coding downstream 26902 68002210 ~ 68080438 (+)
G1009202 NA non-coding downstream 56432 68031740 ~ 68035487 (+)
G1009233 NA non-coding downstream 113441 68088749 ~ 68091504 (+)
G1009244 NA non-coding downstream 139145 68114453 ~ 68114925 (+)
G1008017 NA other upstream 1092702 66881799 ~ 66882251 (+)
LOC110536267 LOC106580513 other upstream 1176736 66774135 ~ 66798230 (+)
G1007556 NA other upstream 1562018 66412574 ~ 66412935 (+)
G1007088 NA other upstream 1957380 66009581 ~ 66017573 (+)
G1007008 NA other upstream 2075585 65898748 ~ 65899368 (+)
LOC110536291 LOC106580540 other downstream 609360 68584627 ~ 68587134 (+)
LOC110535101 LOC106580561 other downstream 824892 68687221 ~ 68847333 (+)
LOC110536300 LOC106580593 other downstream 1423410 69398535 ~ 69400234 (+)
G1011336 NA other downstream 1658193 69633501 ~ 69633876 (+)
sb:cb288 NA other downstream 1730126 69705334 ~ 69711411 (+)

Expression


G1009170 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1009170 Expression in each Bioproject

Bar chart with 15 bars.
G1009170 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 50.
End of interactive chart.

Co-expression Network