G1013476



Basic Information


Item Value
gene id G1013476
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 71613032 ~ 71613352 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1152717
GTCATCTTTCTGTCTCAATGACATCTTTCTGTCTCAATTTTACATTTCAATGTCATCTTTCTGTCTCAATGTCATCTTTCTGTCTCAATGTCATCTTTCTGTCTCAATAGCATCTTTCTGTCTCAATGGCATCTTTAATTGGCATCCTTCTGTCTCAATGGCATCTTTCTATCTCAGTGGCATCTTTCAATGTCATCTTTCTGTCTCCATGTCATCTTTCTGTCTCAATGGCATCTTTCTGTCTCAATGGCACCTTTCTGTCTCAATGGCATCTTTCTGTCTCAATGGCATCTTTCTGTCTCCATGTCATCTTTCTGTCTC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1152717 True 321 lncRNA 0.39 1 71613032 71613352

Neighbor


gene id symbol gene type direction distance location
LOC110536350 NA coding upstream 97603 71507354 ~ 71515429 (+)
LOC110536345 znf367 coding upstream 183329 71422969 ~ 71429703 (+)
LOC110536343 cdc14b coding upstream 205137 71389179 ~ 71407898 (+)
prxl2c aaed1 coding upstream 224163 71386768 ~ 71388869 (+)
LOC110536341 ga45g coding upstream 1426794 70184201 ~ 70186238 (+)
LOC110535107 LOC106580620 coding downstream 23875 71637227 ~ 71737202 (+)
LOC110536353 LOC106580623 coding downstream 125233 71738585 ~ 71797315 (+)
LOC110536646 NA coding downstream 212552 71825904 ~ 71826891 (+)
LOC110536356 LOC106580708 coding downstream 233579 71846931 ~ 71851497 (+)
LOC110536357 LOC106580709 coding downstream 260719 71874071 ~ 71877057 (+)
G1013472 NA non-coding upstream 4980 71607782 ~ 71608052 (+)
G1013389 NA non-coding upstream 118266 71492692 ~ 71494766 (+)
G1013353 NA non-coding upstream 198160 71414645 ~ 71414872 (+)
G1013345 NA non-coding upstream 229927 71382217 ~ 71383105 (+)
G1013478 NA non-coding downstream 3684 71617036 ~ 71617242 (+)
G1013479 NA non-coding downstream 4419 71617771 ~ 71617995 (+)
G1013482 NA non-coding downstream 7518 71620870 ~ 71621175 (+)
G1013485 NA non-coding downstream 13828 71627180 ~ 71627496 (+)
G1013534 NA non-coding downstream 100078 71713430 ~ 71713709 (+)
G1013375 LOC106580618 other upstream 138401 71473426 ~ 71474631 (+)
G1012975 NA other upstream 568428 71044259 ~ 71044604 (+)
LOC110536338 LOC106580595 other upstream 1482181 70128401 ~ 70134490 (+)
G1011531 NA other upstream 1593126 70019103 ~ 70019906 (+)
LOC110536331 LOC106580567 other upstream 1603707 70001416 ~ 70009325 (+)
G1013617 NA other downstream 224986 71838302 ~ 71840882 (+)
G1013922 NA other downstream 265944 71879296 ~ 71879672 (+)
G1014834 NA other downstream 1147169 72760521 ~ 72760945 (+)
LOC110535110 LOC106579812 other downstream 1554251 73155366 ~ 73254792 (+)

Expression


G1013476 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1013476 Expression in each Bioproject

Bar chart with 5 bars.
G1013476 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network