G1013921



Basic Information


Item Value
gene id G1013921
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 71878429 ~ 71878736 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1153227
cattgactctgtaccagtaccccctgtatatagactccacattgactctgtaccagtaccccctgtacatagcctccacattgactctgcaccggcaccccctgtatatagcctccacatagactctgtaccggtaccccctgtatatagtctccacattgactctgtaccggtaccccctgtacatagcctccacattgactctgtaccggtaccccctgtatatagcctccacattgactctgtaccggtaccccctgtatatattctccacattgactctgtaccggcacccccctgtatatagc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1153227 True 308 lncRNA 0.51 1 71878429 71878736
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110536354 LOC106585207 coding downstream 31736 71838302 ~ 71846693 (-)
LOC110536352 LOC106580621 coding downstream 245366 71628579 ~ 71633063 (-)
LOC110536351 NA coding downstream 250933 71620800 ~ 71627496 (-)
LOC100135988 slr coding downstream 279265 71524863 ~ 71599164 (-)
LOC110536349 LOC106580618 coding downstream 389537 71473159 ~ 71488892 (-)
LOC118937382 NA coding upstream 563233 72441969 ~ 72442889 (-)
LOC110536359 LOC106580625 coding upstream 574184 72452920 ~ 72584061 (-)
LOC110536361 LOC106585212 coding upstream 719051 72597787 ~ 72647320 (-)
LOC110536362 LOC106580628 coding upstream 771923 72650659 ~ 72704404 (-)
LOC110535109 LOC106580631 coding upstream 884264 72763000 ~ 72842417 (-)
G1013920 NA non-coding downstream 72 71878073 ~ 71878357 (-)
G1013913 NA non-coding downstream 10533 71867603 ~ 71867896 (-)
G1013901 NA non-coding downstream 18635 71859560 ~ 71859794 (-)
G1013895 NA non-coding downstream 27756 71850366 ~ 71850673 (-)
G1013894 NA non-coding downstream 28966 71849201 ~ 71849463 (-)
G1013923 NA non-coding upstream 500 71879236 ~ 71879495 (-)
G1013924 NA non-coding upstream 856 71879592 ~ 71879944 (-)
G1013955 NA non-coding upstream 94462 71973198 ~ 71993984 (-)
G1013965 NA non-coding upstream 129316 72008052 ~ 72008431 (-)
G1013977 NA non-coding upstream 136109 72014845 ~ 72015057 (-)
G1013669 NA other downstream 362995 71497308 ~ 71515434 (-)
G1012814 NA other downstream 987438 70884476 ~ 70890991 (-)
G1011014 NA other downstream 2572001 69305336 ~ 69306428 (-)
G1010922 NA other downstream 2758943 69116507 ~ 69119486 (-)
G1010443 NA other downstream 3190467 68687257 ~ 68687962 (-)
G1013960 NA other upstream 117345 71996081 ~ 71996688 (-)
G1014411 NA other upstream 480549 72359285 ~ 72359505 (-)
G1014639 NA other upstream 567918 72446654 ~ 72449340 (-)
rnft2 rnft2 other upstream 2424914 74303648 ~ 74312488 (-)
G1017417 NA other upstream 3011663 74890399 ~ 74891140 (-)

Expression


G1013921 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1013921 Expression in each Bioproject

Bar chart with 17 bars.
G1013921 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 75.
End of interactive chart.

Co-expression Network