G1020291 (naaladl1)



Basic Information


Item Value
gene id G1020291
gene name naaladl1
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 77737991 ~ 77739799 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1160635
CGACAGAACGTTCACTCAGCTTGCTGTAATACTCCTCGGTGTACTCTGTGGATCCAATCAGACCGAACTCCTCGGCTCCCCAGCTCCCAAAGATGATGGACCTCCGTGGCCTCCATTTCCCCTGCTTGACCATCCGTCCCAGCACCCGGGTCACCTCCAGCATCACGGAGGTTCCACTGCTGGGGTCGATGGCCCCGTGGACCCAGCTGTCTCTGTGGTTACCGT

Function


symbol description
naaladl1 Predicted to enable carboxypeptidase activity. Predicted to be located in plasma membrane. Predicted to be integral component of membrane. Orthologous to human NAALADL1 (N-acetylated alpha-linked acidic dipeptidase like 1).

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1160635 True 225 lncRNA 0.60 3 77737991 77739799

Neighbor


gene id symbol gene type direction distance location
erap1b LOC106570844 coding downstream 12070 77700933 ~ 77725921 (-)
rad17 rad17 coding downstream 78128 77645962 ~ 77659863 (-)
ccdc125 ccdc125 coding downstream 93187 77619098 ~ 77644804 (-)
fam151b fam151b coding downstream 119732 77605168 ~ 77618259 (-)
LOC118937407 LOC106570835 coding downstream 206107 77529680 ~ 77531884 (-)
LOC110535124 LOC106570849 coding upstream 20130 77759929 ~ 77778022 (-)
LOC118936501 LOC106570849 coding upstream 38262 77778061 ~ 77821554 (-)
LOC110536447 LOC106570860 coding upstream 674994 78414793 ~ 78433486 (-)
LOC110536449 LOC106570861 coding upstream 728734 78468533 ~ 78476320 (-)
LOC110536450 LOC106570886 coding upstream 745317 78485116 ~ 78487202 (-)
G1020273 LOC100196672 non-coding downstream 40043 77696901 ~ 77697948 (-)
G1020271 NA non-coding downstream 43503 77694257 ~ 77694488 (-)
G1020232 NA non-coding downstream 73470 77626634 ~ 77664521 (-)
G1019938 NA non-coding downstream 138157 77598484 ~ 77599834 (-)
G1020296 NA non-coding upstream 8627 77748426 ~ 77748732 (-)
G1020297 NA non-coding upstream 9578 77749377 ~ 77749658 (-)
G1020298 NA non-coding upstream 12406 77752205 ~ 77752422 (-)
G1020299 NA non-coding upstream 13033 77752832 ~ 77753117 (-)
G1020275 NA non-coding upstream 18527 77758326 ~ 77759117 (-)
G1019926 NA other downstream 161327 77575871 ~ 77576664 (-)
G1019413 NA other downstream 781174 76955366 ~ 76956817 (-)
G1019056 NA other downstream 1192250 76545108 ~ 76545741 (-)
ckap2l LOC106570813 other downstream 1491104 76202025 ~ 76246958 (-)
G1021084 NA other upstream 813829 78553628 ~ 78566847 (-)
G1021129 NA other upstream 893822 78633621 ~ 78634401 (-)
G1021664 NA other upstream 1682711 79422510 ~ 79423479 (-)
G1021853 NA other upstream 1965420 79705219 ~ 79705722 (-)

Expression



Co-expression Network