G1020950


Basic Information

Item Value
gene id G1020950
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 78870769 ~ 78871544 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1161431
gaggctatatacagggggtaccggtacagagtcaatgtggaggctatatacagggggtaccagtacagagtcaatgtggaggctatatacagggggtaccggtactgagtcaatgtggaggctatatacagggggtaccagtacagagtcaatgtggaggctatatacagggggtaccagtacagagtcaatgtggaggctatatacagggggtaccagtacagagtcaatgtggaggatatatacagggggtaccggtactgagtcaatgtggaggctatatacagggggtaccggtacagagtcaatgtggaggctatatacagggggtaccggtacagagtcaatgtggaggctatatacaggtggtaccggtacagagtcaatgtggaggctatatacagggggtaccagtacagagtcaatgtggaggatatatacagggggtaccggtacagagtcaatgtggaggctatatacaggggggtactggtacagagtcaatgtggaggctatatacagggggtaccggtacagagtcaatgtggaggctatatacagggggtaccggtacagagtca

Function

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1161431 True 581 TUCP 0.50 2 78870769 78871544

Neighbor

gene id symbol gene type direction distance location
LOC110536455 NA coding upstream 57392 78804489 ~ 78813377 (+)
cxcl13 cxcl13 coding upstream 99315 78770002 ~ 78772053 (+)
LOC110536454 LOC100170204 coding upstream 139665 78730292 ~ 78731104 (+)
LOC100135977 LOC100135977 coding upstream 152207 78716975 ~ 78718562 (+)
LOC118937413 LOC100170204 coding upstream 160112 78708377 ~ 78711162 (+)
LOC110536458 LOC106570892 coding downstream 300353 79171897 ~ 79182526 (+)
LOC110536457 LOC106585928 coding downstream 461335 79332879 ~ 79486262 (+)
paqr3a LOC106570899 coding downstream 989764 79861308 ~ 79876704 (+)
LOC110536463 graa coding downstream 1149917 80021461 ~ 80023984 (+)
gc LOC106570911 coding downstream 1264879 80136423 ~ 80158994 (+)
G1020913 LOC106585873 non-coding upstream 88786 78772505 ~ 78781983 (+)
G1020895 NA non-coding upstream 128365 78742191 ~ 78742404 (+)
G1020870 NA non-coding upstream 198473 78671666 ~ 78672296 (+)
G1020859 NA non-coding upstream 236369 78633810 ~ 78634400 (+)
G1020994 NA non-coding downstream 106167 78977711 ~ 78978042 (+)
G1021030 NA non-coding downstream 180330 79051874 ~ 79052306 (+)
G1021044 NA non-coding downstream 221039 79092583 ~ 79093858 (+)
G1021045 NA non-coding downstream 221469 79093013 ~ 79094993 (+)
G1021057 NA non-coding downstream 269342 79140886 ~ 79141360 (+)
G1020906 NA other upstream 109499 78760943 ~ 78761270 (+)
LOC100301634 LOC100135977 other upstream 181088 78686700 ~ 78689681 (+)
LOC118937412 LOC100170204 other upstream 190679 78677740 ~ 78680090 (+)
G1021790 NA other downstream 769378 79640922 ~ 79641315 (+)
G1021851 NA other downstream 831698 79703242 ~ 79704144 (+)
G1021894 NA other downstream 875498 79747042 ~ 79748127 (+)
G1021985 LOC106570898 other downstream 1039781 79911325 ~ 79919605 (+)
G1022153 NA other downstream 1182135 80053029 ~ 80054676 (+)

Expression

G1020950 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1020950 Expression in each Bioproject

Bar chart with 20 bars.
G1020950 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network