G1021597



Basic Information


Item Value
gene id G1021597
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 79519384 ~ 79576908 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1162243
gaactctatctgagaatctcacagtggaattaccctgtagaactctatctaagagtctcacagtggaattaccctgtagaactctatctaagagtctcacagtggaattaccctgtagaactctatctaagagtctcacagtggaattaccctgtagaactctaagagtctcacagtggaattaccctgtagaactctatctaagagtctcacagtggaattaccctgtagaactc

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1162243 True 236 lncRNA 0.42 2 79519384 79576908

Neighbor


gene id symbol gene type direction distance location
LOC110536457 LOC106585928 coding upstream 33122 79332879 ~ 79486262 (+)
LOC110536458 LOC106570892 coding upstream 336858 79171897 ~ 79182526 (+)
fras1 LOC106585923 coding upstream 352031 78815347 ~ 79167353 (+)
LOC110536455 NA coding upstream 706007 78804489 ~ 78813377 (+)
cxcl13 cxcl13 coding upstream 747930 78770002 ~ 78772053 (+)
paqr3a LOC106570899 coding downstream 284400 79861308 ~ 79876704 (+)
LOC110536463 graa coding downstream 444553 80021461 ~ 80023984 (+)
gc LOC106570911 coding downstream 559515 80136423 ~ 80158994 (+)
LOC110535134 LOC106570910 coding downstream 601598 80178506 ~ 80282552 (+)
LOC110536468 lipe coding downstream 753506 80330414 ~ 80351180 (+)
G1021577 NA non-coding upstream 31640 79487044 ~ 79487744 (+)
G1021568 NA non-coding upstream 56261 79461695 ~ 79463123 (+)
G1021561 NA non-coding upstream 80299 79436807 ~ 79439085 (+)
G1021559 NA non-coding upstream 87235 79431562 ~ 79432149 (+)
G1021542 NA non-coding upstream 133971 79385179 ~ 79385413 (+)
G1021739 NA non-coding downstream 9505 79586413 ~ 79586656 (+)
G1021741 NA non-coding downstream 10315 79587223 ~ 79587699 (+)
G1021763 NA non-coding downstream 39214 79616122 ~ 79616340 (+)
G1021766 NA non-coding downstream 41566 79618474 ~ 79618785 (+)
G1021771 NA non-coding downstream 46147 79623055 ~ 79623292 (+)
G1020950 NA other upstream 647840 78870769 ~ 78871544 (+)
G1020906 NA other upstream 758114 78760943 ~ 78761270 (+)
LOC118937413 LOC100170204 other upstream 808222 78708377 ~ 78711162 (+)
LOC100301634 LOC100135977 other upstream 829703 78686700 ~ 78689681 (+)
G1021790 NA other downstream 64014 79640922 ~ 79641315 (+)
G1021851 NA other downstream 126334 79703242 ~ 79704144 (+)
G1021894 NA other downstream 170134 79747042 ~ 79748127 (+)
G1021985 LOC106570898 other downstream 334417 79911325 ~ 79919605 (+)
G1022153 NA other downstream 476771 80053029 ~ 80054676 (+)

Expression


G1021597 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G1021597 Expression in each Bioproject

Bar chart with 3 bars.
G1021597 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network