G1021791



Basic Information


Item Value
gene id G1021791
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 79641354 ~ 79641637 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1162490
ttctcccattgcaaatctaccattccagtgttttacttgttatattgtatctactttgccaccatggcctttttgcctttacctcccttatctcacctcatttgctcacatcgtatatagacttgtttatactgtattattgactgtatgtttgttttactccatgtgtaactctgtgtcgttgtatgtgttgaactgctttgctttatcttggccaggtcgcaattgtaaatgagaacttgttctcaacttgcctacctggttaaataaaggtgaaataaaat

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1162490 True 284 lncRNA 0.37 1 79641354 79641637
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110536457 LOC106585928 coding upstream 155092 79332879 ~ 79486262 (+)
LOC110536458 LOC106570892 coding upstream 458828 79171897 ~ 79182526 (+)
fras1 LOC106585923 coding upstream 474001 78815347 ~ 79167353 (+)
LOC110536455 NA coding upstream 827977 78804489 ~ 78813377 (+)
cxcl13 cxcl13 coding upstream 869900 78770002 ~ 78772053 (+)
paqr3a LOC106570899 coding downstream 219671 79861308 ~ 79876704 (+)
LOC110536463 graa coding downstream 379824 80021461 ~ 80023984 (+)
gc LOC106570911 coding downstream 494786 80136423 ~ 80158994 (+)
LOC110535134 LOC106570910 coding downstream 536869 80178506 ~ 80282552 (+)
LOC110536468 lipe coding downstream 688777 80330414 ~ 80351180 (+)
G1021785 NA non-coding upstream 1872 79638837 ~ 79639482 (+)
G1021777 NA non-coding upstream 11521 79629510 ~ 79629833 (+)
G1021773 NA non-coding upstream 17196 79623913 ~ 79624158 (+)
G1021771 NA non-coding upstream 18062 79623055 ~ 79623292 (+)
G1021766 NA non-coding upstream 22569 79618474 ~ 79618785 (+)
G1021794 NA non-coding downstream 1811 79643448 ~ 79643744 (+)
G1021797 NA non-coding downstream 8109 79649746 ~ 79650059 (+)
G1021816 NA non-coding downstream 30198 79671835 ~ 79672179 (+)
G1021856 NA non-coding downstream 67096 79708733 ~ 79708977 (+)
G1021857 NA non-coding downstream 73854 79715491 ~ 79715700 (+)
G1021790 NA other upstream 39 79640922 ~ 79641315 (+)
G1020950 NA other upstream 769810 78870769 ~ 78871544 (+)
G1020906 NA other upstream 880084 78760943 ~ 78761270 (+)
LOC118937413 LOC100170204 other upstream 930192 78708377 ~ 78711162 (+)
G1021851 NA other downstream 61605 79703242 ~ 79704144 (+)
G1021894 NA other downstream 105405 79747042 ~ 79748127 (+)
G1021985 LOC106570898 other downstream 269688 79911325 ~ 79919605 (+)
G1022153 NA other downstream 412042 80053029 ~ 80054676 (+)
LOC110536472 LOC106570904 other downstream 969224 80610620 ~ 80617171 (+)

Expression


G1021791 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1021791 Expression in each Bioproject

Bar chart with 18 bars.
G1021791 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network