G1024048



Basic Information


Item Value
gene id G1024048
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 82290650 ~ 82290924 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1165293
CATCAAATTCTAATAAAAATGAAACAACTACTTGTTTTAAAATAGGCTATGTCTAGATACAGTTCCAGGAACAGTTTTAAAATAGGCTGTCTAGATACAGTTCCAGGCACAGTTTTAAAATAGGCTGTCTAGATACAGTTCCAGGAACAGTTTTAAAATAGGCTGTCTAGATACAGTTCCAGGAACAGTTTTAAAATAGGCTGTCTAAATACAGTTCCAGGAACAGTTTTAAAAT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1165293 True 235 lncRNA 0.33 2 82290650 82290924
Loading

Neighbor


gene id symbol gene type direction distance location
si:dkey-3h3.3 LOC106570931 coding upstream 133658 82150351 ~ 82156992 (+)
arl15a arl15 coding upstream 980909 81194406 ~ 81309741 (+)
LOC110536657 LOC106570919 coding upstream 1181595 81024570 ~ 81109055 (+)
tmem175 tmem175 coding upstream 1574441 80688281 ~ 80784594 (+)
LOC110535135 LOC106570905 coding upstream 1604833 80625161 ~ 80685817 (+)
LOC110536489 LOC106570933 coding downstream 332351 82623275 ~ 82627340 (+)
pias2 LOC106570963 coding downstream 1018145 83309069 ~ 83342180 (+)
LOC110536502 LOC106570967 coding downstream 1309802 83600726 ~ 83617784 (+)
tut7 LOC100380868 coding downstream 1343460 83634384 ~ 83698037 (+)
isca1 LOC106570962 coding downstream 1413628 83704552 ~ 83716824 (+)
G1024044 NA non-coding upstream 4559 82285831 ~ 82286091 (+)
G1024041 LOC106570928 non-coding upstream 8155 82282115 ~ 82282495 (+)
G1024012 NA non-coding upstream 84830 82205504 ~ 82205820 (+)
G1023976 NA non-coding upstream 114617 82123637 ~ 82176033 (+)
G1024060 NA non-coding downstream 23063 82313987 ~ 82314901 (+)
G1024074 NA non-coding downstream 51693 82342617 ~ 82343063 (+)
G1024100 NA non-coding downstream 117299 82408223 ~ 82409078 (+)
G1024101 NA non-coding downstream 119068 82409992 ~ 82413439 (+)
G1024118 NA non-coding downstream 157887 82448811 ~ 82449514 (+)
G1023978 NA other upstream 160009 82127889 ~ 82130641 (+)
G1023980 NA other upstream 160787 82128825 ~ 82129863 (+)
G1023377 ndufs4 other upstream 747005 81497785 ~ 81543645 (+)
G1023251 NA other upstream 1005020 81285018 ~ 81285630 (+)
LOC110536472 LOC106570904 other upstream 1678360 80610620 ~ 80617171 (+)
G1025108 NA other downstream 1466538 83757462 ~ 83760475 (+)
G1026397 NA other downstream 2668605 84959529 ~ 84960032 (+)
G1026425 NA other downstream 2693676 84984600 ~ 84985246 (+)
G1026580 NA other downstream 2892876 85183800 ~ 85197735 (+)

Expression


G1024048 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1024048 Expression in each Bioproject

Bar chart with 7 bars.
G1024048 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network