G1025620


Basic Information

Item Value
gene id G1025620
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 83860659 ~ 83860932 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1167263
ctccgatccaacaggtcccagacctgctcaatggaattgagatccgggctcttcactggccatggcagaacactgacattcctgtcttgcaggaaatcacgcacagaatgagcagtatggctggtggcattgtcatgctggagggtcatgtcaggatgagcctgcaggaagggtaccacatgagggaggaggatgtcttccctgtaacgcacagcgttgagattgcctgcaatgacaacaagctcagtccgatgatgctgtgacacatcgcccc

Function

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1167263 True 274 lncRNA 0.54 1 83860659 83860932

Neighbor

gene id symbol gene type direction distance location
LOC118937426 LOC100380868 coding downstream 164053 83692703 ~ 83698034 (-)
LOC110536498 LOC105030224 coding downstream 499645 83341427 ~ 83361014 (-)
LOC110536507 LOC105014547 coding downstream 571710 83064063 ~ 83288949 (-)
LOC100136308 LOC106570939 coding downstream 898628 82873779 ~ 82962031 (-)
LOC118937425 NA coding downstream 986935 82872722 ~ 82873724 (-)
ypel1 ypel1 coding upstream 15002 83873900 ~ 83903039 (-)
LOC110536511 NA coding upstream 53881 83914813 ~ 83921303 (-)
LOC110535142 mapk1 coding upstream 61676 83922608 ~ 83982640 (-)
grsf1 grsf1 coding upstream 184580 84045512 ~ 84084200 (-)
adamts3 LOC107719190 coding upstream 374361 84235293 ~ 84426152 (-)
G1025619 NA non-coding downstream 588 83859860 ~ 83860071 (-)
G1025615 NA non-coding downstream 4562 83855686 ~ 83856097 (-)
G1025612 NA non-coding downstream 7024 83852913 ~ 83853635 (-)
G1025610 NA non-coding downstream 8171 83849713 ~ 83852488 (-)
G1025607 NA non-coding downstream 15402 83843899 ~ 83845257 (-)
G1025593 NA non-coding upstream 9222 83870154 ~ 83871329 (-)
G1025595 NA non-coding upstream 12378 83873310 ~ 83873797 (-)
G1025627 NA non-coding upstream 18749 83879681 ~ 83880942 (-)
G1025642 NA non-coding upstream 45650 83906582 ~ 83907246 (-)
G1025643 NA non-coding upstream 46468 83907400 ~ 83908226 (-)
G1025498 NA other downstream 142051 83683265 ~ 83718776 (-)
G1025467 NA other downstream 233869 83544297 ~ 83626790 (-)
G1025481 NA other downstream 295085 83562302 ~ 83565574 (-)
LOC110536484 LOC106570928 other downstream 1601694 82257489 ~ 82522382 (-)
G1023858 NA other downstream 1946292 81912957 ~ 81914367 (-)
G1026586 NA other upstream 1326394 85187326 ~ 85197500 (-)
G1026978 NA other upstream 1752420 85613352 ~ 85614375 (-)

Expression

G1025620 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 100.
End of interactive chart.

G1025620 Expression in each Bioproject

Bar chart with 21 bars.
G1025620 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 3000.
End of interactive chart.

Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location