G1026434



Basic Information


Item Value
gene id G1026434
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 85027857 ~ 85028209 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1168255
gaccattcacagagacaaactgatatctttccgacagataagatctaaaccaggccagaacttgtccgtgtagaccaatttgggtttccaatctctccaaaagaatgtggtgatcgatggtatcaaaagcagcactaaggtctaggagcacgaggacagatgcagagcctcggtccgatgccattaaaatgtaatttaccaccttcacaagtgccgtctcagtgctatgatggggtctaaaaccagactgaagcatttcgtatacattgtttgtcttcaggaaggcagtgagttgttgcgcaacagccttttctaaaatttttgagaggaatggaagattcgatatagaccga

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1168255 True 353 lncRNA 0.44 1 85027857 85028209

Neighbor


gene id symbol gene type direction distance location
dmrt2a LOC106570979 coding downstream 62090 84961291 ~ 84965767 (-)
smarca2 NA coding downstream 308051 84501885 ~ 84719806 (-)
adamts3 LOC107719190 coding downstream 601705 84235293 ~ 84426152 (-)
grsf1 grsf1 coding downstream 943657 84045512 ~ 84084200 (-)
LOC110535142 mapk1 coding downstream 1045217 83922608 ~ 83982640 (-)
LOC118937429 dmrt3 coding upstream 17905 85046114 ~ 85122372 (-)
kank1a kank1 coding upstream 211400 85239609 ~ 85392002 (-)
dapk1 dapk1 coding upstream 423976 85452185 ~ 85658741 (-)
LOC118937430 NA coding upstream 492370 85520579 ~ 85522516 (-)
tmem8b tmem8b coding upstream 1013533 86041742 ~ 86232638 (-)
G1026429 NA non-coding downstream 1998 85025621 ~ 85025859 (-)
G1026428 NA non-coding downstream 2416 85025074 ~ 85025441 (-)
G1026427 NA non-coding downstream 5863 85021737 ~ 85021994 (-)
G1026426 NA non-coding downstream 27639 84999990 ~ 85000218 (-)
G1026423 NA non-coding downstream 47779 84979821 ~ 84980078 (-)
G1026435 NA non-coding upstream 634 85028843 ~ 85029227 (-)
G1026447 NA non-coding upstream 11654 85039863 ~ 85040103 (-)
G1026460 NA non-coding upstream 22145 85050354 ~ 85056513 (-)
G1026466 NA non-coding upstream 31775 85059984 ~ 85060569 (-)
G1026472 NA non-coding upstream 44552 85072761 ~ 85073064 (-)
ypel1 ypel1 other downstream 1124818 83873900 ~ 83903039 (-)
G1025498 NA other downstream 1309249 83683265 ~ 83718776 (-)
G1025467 NA other downstream 1401067 83544297 ~ 83626790 (-)
G1025481 NA other downstream 1462283 83562302 ~ 83565574 (-)
LOC110536484 LOC106570928 other downstream 2768892 82257489 ~ 82522382 (-)
G1026586 NA other upstream 159117 85187326 ~ 85197500 (-)
G1026978 NA other upstream 585143 85613352 ~ 85614375 (-)

Expression


G1026434 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 100.
End of interactive chart.

G1026434 Expression in each Bioproject

Bar chart with 20 bars.
G1026434 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network