LOC110536782



Basic Information


Item Value
gene id LOC110536782
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 11875159 ~ 11885599 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>LOC110536782
ATGGAGACACAGACCCTAATGCAGAACCACATGAGAAAGAGGCAAATGGCCATGTAGATTGCCTGATCCAGGGAGTTCCTCAAATACTTCTTCAGCCTGGCCTCACTAGGCCTCACCATTGGTGCTATTAAGAAGAGGAAGCTGGCCTTCTGCCCCCGTCATACCTCTCAGCTTCGTTCTGGCCTATCAGATGGACATGGCGTATGGAACGCGTATCTACCACATGGGGAATGAGGCAGAGAGCACCATGGTCTCAGAGCAGGACCGATTGGACATTCCAAGTGGTGTGCCCAACTTCGTGAGCATTGAGAAGGTAAGAAGAGCTCCCTGAGCTCCCTCTTTGAGAAATGACACAAACACTGTCCTGCCATGGGTGGGTGTTGTTCAGGGTTGTTCACACCTCTGATCTCCACCCCTGGAAGTCAGTGAGTGAAGCTCCTCTGTCCCCAAGATCAATTTTCATCAAGTCTTCGCCTCAGTTATGTT

Function


NR:

description
plasminogen receptor (KT) isoform X2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
LOC110536782 True 486 mRNA 0.51 3 11875159 11885599

Neighbor


gene id symbol gene type direction distance location
LOC110536969 LOC106568440 coding upstream 123528 11705592 ~ 11751631 (+)
LOC110536966 LOC106568436 coding upstream 178703 11678374 ~ 11696456 (+)
LOC110536962 LOC103361660 coding upstream 259204 11606340 ~ 11615955 (+)
LOC110536961 LOC106568434 coding upstream 273766 11568368 ~ 11602303 (+)
LOC110539116 NA coding upstream 362597 11511158 ~ 11512562 (+)
LOC110536973 LOC106568451 coding downstream 3071 11888670 ~ 11890759 (+)
ak3 LOC106568444 coding downstream 120546 12006145 ~ 12017505 (+)
exd3 exd3 coding downstream 150385 12035984 ~ 12100063 (+)
LOC110536980 LOC106568448 coding downstream 222769 12108368 ~ 12112859 (+)
LOC110536981 NA coding downstream 271614 12157213 ~ 12165513 (+)
G1037698 NA non-coding upstream 93157 11781703 ~ 11782002 (+)
G1037690 NA non-coding upstream 99380 11775479 ~ 11775779 (+)
G1037613 NA non-coding upstream 233443 11641083 ~ 11641716 (+)
G1037754 NA non-coding downstream 5775 11891374 ~ 11895208 (+)
G1037745 LOC106568442 non-coding downstream 17140 11902739 ~ 11907536 (+)
G1037788 NA non-coding downstream 73940 11959539 ~ 11963490 (+)
G1037810 LOC100194703 non-coding downstream 106312 11991911 ~ 11992238 (+)
G1037811 NA non-coding downstream 106876 11992475 ~ 11992996 (+)
G1037472 NA other upstream 419963 11452006 ~ 11455196 (+)
G1036562 LOC106568456 other upstream 914036 10958408 ~ 10961123 (+)
G1036319 NA other upstream 1402086 10470315 ~ 10473073 (+)
ctif ctif other upstream 1444980 10237527 ~ 10430266 (+)
G1039147 NA other downstream 1239325 13124924 ~ 13126167 (+)
G1039430 LOC106568378 other downstream 1396773 13282372 ~ 13283170 (+)
G1040196 NA other downstream 2280071 14165670 ~ 14169934 (+)
G1040578 NA other downstream 2531082 14416681 ~ 14416991 (+)
G1041168 LOC106568367 other downstream 3010759 14896358 ~ 14903843 (+)

Expression


LOC110536782 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.6.
End of interactive chart.

LOC110536782 Expression in each Bioproject

Bar chart with 8 bars.
LOC110536782 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 5.
End of interactive chart.

Co-expression Network