LOC118937980



Basic Information


Item Value
gene id LOC118937980
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 40175351 ~ 40175541 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XR_005035384.1
atcgcttctcggccttttggctcagatcaagtgtagtatctgttcttatcagtttaatatctgatacgtcccccatcgggggactacatattaaatggatttttcgaacagggagtcggaaatggggcttgctccgtccgctccacgcatcgacccggtattgcagtacctccgggaacggtgcaacactt

Function


NR:

description
LOC569167 protein, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_005035384.1 True 191 mRNA 0.50 1 40175351 40175541

Neighbor


gene id symbol gene type direction distance location
htr3a LOC106567725 coding upstream 611581 39556689 ~ 39563770 (+)
htr3b LOC106567726 coding upstream 619780 39546047 ~ 39555571 (+)
LOC110537603 LOC106567719 coding upstream 773631 39380904 ~ 39401720 (+)
LOC110538893 rfc2 coding upstream 803993 39362997 ~ 39371358 (+)
LOC118937671 NA coding upstream 813325 39358964 ~ 39362026 (+)
cadm1a LOC106567730 coding downstream 335617 40511158 ~ 40938098 (+)
LOC110539145 NA coding downstream 853799 41029340 ~ 41030449 (+)
anapc13 anc13 coding downstream 950866 41126407 ~ 41130505 (+)
LOC110537617 LOC106567734 coding downstream 1504002 41679543 ~ 41732016 (+)
LOC110537618 LOC105024202 coding downstream 1574404 41749945 ~ 41762641 (+)
G1070165 NA non-coding upstream 120170 40054914 ~ 40055181 (+)
G1070164 NA non-coding upstream 122959 40052170 ~ 40052392 (+)
G1069735 LOC106567728 non-coding upstream 400639 39755566 ~ 39774712 (+)
G1069722 NA non-coding upstream 452731 39722400 ~ 39722620 (+)
G1068904 NA non-coding upstream 589121 39583845 ~ 39586230 (+)
G1070367 NA non-coding downstream 86443 40261984 ~ 40262244 (+)
G1070438 NA non-coding downstream 87756 40263297 ~ 40263514 (+)
G1070442 NA non-coding downstream 89030 40264571 ~ 40264945 (+)
G1070467 NA non-coding downstream 108716 40284257 ~ 40284460 (+)
G1070471 NA non-coding downstream 111541 40287082 ~ 40287415 (+)
styxl1 styxl1 other upstream 1085408 39077007 ~ 39090045 (+)
prkrip1 LOC106567678 other upstream 1933978 38231737 ~ 38241376 (+)
G1067321 LOC106567676 other upstream 2006403 38168337 ~ 38168948 (+)
G1067221 NA other upstream 2236075 37938832 ~ 37939276 (+)
G1067156 LOC100380745 other upstream 2309876 37854888 ~ 37865475 (+)
G1070479 NA other downstream 116911 40292452 ~ 40292734 (+)
G1071144 NA other downstream 939037 41114578 ~ 41114957 (+)
G1071159 NA other downstream 961895 41137436 ~ 41137868 (+)
G1072789 NA other downstream 2021509 42197050 ~ 42216163 (+)
G1074265 NA other downstream 3669626 43845167 ~ 43845968 (+)

Expression


LOC118937980 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 80.
End of interactive chart.

LOC118937980 Expression in each Bioproject

Bar chart with 9 bars.
LOC118937980 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 700.
End of interactive chart.

Co-expression Network