LOC110538453



Basic Information


Item Value
gene id LOC110538453
gene name NA
gene type coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 73610529 ~ 73611047 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>XR_005035133.1
TGCAAAACCGGAAAACAAACACTGACAACATGGTTGAATGGACAGACGCAGAGAATAGCACCATCAGTGCTGTCTGGGGCAAAGTAGATATCAATGAGATCGGACCACTGGCTCTGGGAAGAGTCCTGATCGTCTACCCCGGCTCTTTCGGAGATGTGTCCACTCCCGCAGCAATCATGGGCAACCCCAAAAGTTGCTGCTCACGGCAGGGTCGTGTGTGGAGCTCTGGATAAAGCTGTGAAGAACATGGGCAACATCTTGGCCACATACAAGTCACTGAGCGAGACCCAC

Function


NR:

description
Hemoglobin subunit beta-1

GO:

id name namespace
GO:0015671 oxygen transport biological_process
GO:0005833 hemoglobin complex cellular_component
GO:0005506 iron ion binding molecular_function
GO:0019825 oxygen binding molecular_function
GO:0005344 oxygen carrier activity molecular_function
GO:0020037 heme binding molecular_function

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
XR_005035133.1 True 291 mRNA 0.52 2 73610529 73611047
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110538445 LOC100136291 coding downstream 10608 73595266 ~ 73599921 (-)
LOC118936252 LOC106601074 coding downstream 15116 73590430 ~ 73595413 (-)
hbb1 LOC106601074 coding downstream 27006 73582572 ~ 73583523 (-)
LOC110538444 LOC100136291 coding downstream 43420 73566045 ~ 73567109 (-)
LOC110538446 LOC106601074 coding downstream 49250 73560334 ~ 73561279 (-)
LOC110538443 LOC100136576 coding upstream 6064 73617111 ~ 73618238 (-)
LOC118937729 LOC106601065 coding upstream 21636 73632683 ~ 73633582 (-)
LOC118937730 LOC106601065 coding upstream 27692 73638739 ~ 73639637 (-)
LOC118937731 LOC106601065 coding upstream 33663 73644710 ~ 73645608 (-)
LOC110513323 LOC106601065 coding upstream 39786 73650833 ~ 73651731 (-)
G1110372 NA non-coding downstream 20699 73562820 ~ 73589830 (-)
G1110370 LOC106601071 non-coding downstream 22163 73569181 ~ 73588366 (-)
G1110391 NA non-coding downstream 54764 73555516 ~ 73555765 (-)
G1109433 NA non-coding downstream 405251 73205038 ~ 73205278 (-)
G1109426 NA non-coding downstream 423201 73186878 ~ 73187328 (-)
G1110409 LOC100135791 non-coding upstream 18012 73629059 ~ 73641390 (-)
G1110412 LOC100135791 non-coding upstream 36090 73647137 ~ 73653511 (-)
G1110410 LOC106607381 non-coding upstream 39105 73650152 ~ 73679408 (-)
G1110447 NA non-coding upstream 101829 73712876 ~ 73715294 (-)
G1110450 NA non-coding upstream 104646 73715693 ~ 73716381 (-)
G1110369 hbb1 other downstream 15171 73582194 ~ 73595358 (-)
LOC110538455 LOC106601085 other downstream 140920 73462257 ~ 73510350 (-)
G1109389 LOC106601099 other downstream 529127 73072892 ~ 73081402 (-)
G1109275 NA other downstream 685278 72924157 ~ 72925251 (-)
LOC110538266 LOC106601105 other downstream 811265 72778068 ~ 72800352 (-)
G1110374 NA other upstream 1530 73612577 ~ 73614268 (-)
LOC110538422 LOC106601282 other upstream 457238 74068285 ~ 74079316 (-)
G1110701 NA other upstream 593174 74204221 ~ 74205191 (-)
G1110941 NA other upstream 1039236 74650283 ~ 74650763 (-)
G1111424 LOC106601260 other upstream 1206928 74817975 ~ 74824590 (-)

Expression


LOC110538453 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

LOC110538453 Expression in each Bioproject

Bar chart with 13 bars.
LOC110538453 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 800.
End of interactive chart.

Co-expression Network