G1028466



Basic Information


Item Value
gene id G1028466
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 1317341 ~ 1323390 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1170879
ggtttatattctgttggtttatattctgttggtttatattatgttggtgatttatattctgttggtgggttatattctgttgttggttcatattctgttggtttaaattctgttgttggtttatattttgttgctggtttatattctgttggtggtttattttctgttggtttatattctgttggtttatattctgttggtgatttatattctgttggtgatttatattctgtcggtggtttatattctgttggtggtttatattctgttggt

Function


NR:

description
uncharacterized protein LOC111231693

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1170879 True 273 lncRNA 0.30 2 1317341 1323390
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110536893 txnl1 coding upstream 372155 917211 ~ 945186 (+)
katnal2 katnal2 coding upstream 956890 339376 ~ 360451 (+)
sigmar1 sigmar1 coding upstream 981745 324934 ~ 335596 (+)
cntfr cntfr coding downstream 1209194 2532584 ~ 3047731 (+)
LOC118937614 NA coding downstream 1363438 2686828 ~ 2716994 (+)
il11ra LOC106568611 coding downstream 1772144 3095534 ~ 3206784 (+)
LOC118937617 NA coding downstream 2298006 3621059 ~ 3622127 (+)
LOC110536763 LOC106572512 coding downstream 2812930 4136320 ~ 4226240 (+)
G1028464 NA non-coding upstream 106 1315793 ~ 1317235 (+)
G1028461 NA non-coding upstream 9429 1306517 ~ 1307912 (+)
G1028443 NA non-coding upstream 40836 1275864 ~ 1276505 (+)
G1028442 NA non-coding upstream 41553 1274163 ~ 1275788 (+)
G1028439 NA non-coding upstream 46005 1270266 ~ 1271336 (+)
G1028480 NA non-coding downstream 54881 1378271 ~ 1380195 (+)
G1028494 NA non-coding downstream 97304 1420694 ~ 1421788 (+)
G1028517 NA non-coding downstream 150163 1473553 ~ 1474021 (+)
G1028527 NA non-coding downstream 168763 1492153 ~ 1492901 (+)
G1028530 NA non-coding downstream 172366 1495756 ~ 1499419 (+)
G1028416 NA other upstream 91943 1224701 ~ 1225398 (+)
G1028361 NA other upstream 209615 1107151 ~ 1107726 (+)
G1028327 NA other upstream 318705 998270 ~ 998636 (+)
G1028240 LOC106568532 other upstream 423579 881163 ~ 893762 (+)
G1028184 NA other upstream 536481 758922 ~ 780860 (+)
G1028508 NA other downstream 135957 1459347 ~ 1459903 (+)
G1028513 NA other downstream 145185 1468575 ~ 1469776 (+)
G1028515 NA other downstream 146460 1469850 ~ 1470695 (+)
LOC110517257 tcf4 other downstream 153321 1152988 ~ 1562821 (+)
G1028573 NA other downstream 389141 1712531 ~ 1714574 (+)

Expression


G1028466 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G1028466 Expression in each Bioproject

Bar chart with 12 bars.
G1028466 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 350.
End of interactive chart.

Co-expression Network