G1028508



Basic Information


Item Value
gene id G1028508
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 1459347 ~ 1459903 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1170931
AGGTAGGTATGATAGGTCTCTCTGATAGACAGGTAGGTATGATAGGTCTCTCTGATAGACAGGTAGGTATGATAGGCCTCTCTGTTAGACAGGTAGGTATGTTAGGTCTCTCTGATAGACAGGTAGGTATGATAGGTCTCTCTGATAGACAGGTAGGTATGATAAGCCTCTCTGTTAGACAGGTAGGTATGATAGGCCTCTCTGTTAGACAGGTAGGTATGATAGGCCTCTCTGTTAGACAGGTAGGTATGATAGGTCTCTCTGTTAGACAGGTAGGTATGATAGGCCTCTCTGTTAGACAGGTAGGTATGATAGGTCTCTCTGATAGACAGGTAGGTATGATAGGCCTCTATGTTAGACAGGTAGGTATGATAGGTCTCTCTGATAGACAGGTAGGTATGATAGGTCTCTCTGATAGACAGGTAGGTATGATAGGCCTCTCTGTTAGACAGGTAGGTATGATAGGTCTCTCTGATAGACAGGTAGGTATGATAGGC

Function


NR:

description
PREDICTED: uncharacterized protein LOC106591269 isoform X2

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1170931 True 497 TUCP 0.44 2 1459347 1459903
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110536893 txnl1 coding upstream 514161 917211 ~ 945186 (+)
katnal2 katnal2 coding upstream 1098896 339376 ~ 360451 (+)
sigmar1 sigmar1 coding upstream 1123751 324934 ~ 335596 (+)
cntfr cntfr coding downstream 1072681 2532584 ~ 3047731 (+)
LOC118937614 NA coding downstream 1226925 2686828 ~ 2716994 (+)
il11ra LOC106568611 coding downstream 1635631 3095534 ~ 3206784 (+)
LOC118937617 NA coding downstream 2161493 3621059 ~ 3622127 (+)
LOC110536763 LOC106572512 coding downstream 2676417 4136320 ~ 4226240 (+)
G1028494 NA non-coding upstream 37559 1420694 ~ 1421788 (+)
G1028480 NA non-coding upstream 79152 1378271 ~ 1380195 (+)
G1028459 NA non-coding upstream 105750 1304335 ~ 1353597 (+)
G1028467 NA non-coding upstream 119384 1318900 ~ 1339963 (+)
G1028466 NA non-coding upstream 135957 1317341 ~ 1323390 (+)
G1028517 NA non-coding downstream 13650 1473553 ~ 1474021 (+)
G1028527 NA non-coding downstream 32250 1492153 ~ 1492901 (+)
G1028530 NA non-coding downstream 35853 1495756 ~ 1499419 (+)
G1028532 NA non-coding downstream 43789 1503692 ~ 1504471 (+)
G1028541 NA non-coding downstream 81369 1541272 ~ 1545254 (+)
G1028416 NA other upstream 233949 1224701 ~ 1225398 (+)
G1028361 NA other upstream 351621 1107151 ~ 1107726 (+)
G1028327 NA other upstream 460711 998270 ~ 998636 (+)
G1028240 LOC106568532 other upstream 565585 881163 ~ 893762 (+)
G1028513 NA other downstream 8672 1468575 ~ 1469776 (+)
G1028515 NA other downstream 9947 1469850 ~ 1470695 (+)
LOC110517257 tcf4 other downstream 16808 1152988 ~ 1562821 (+)
G1028573 NA other downstream 252628 1712531 ~ 1714574 (+)
G1029035 NA other downstream 427244 1887147 ~ 1887594 (+)

Expression


G1028508 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

G1028508 Expression in each Bioproject

Bar chart with 15 bars.
G1028508 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network