G1029607



Basic Information


Item Value
gene id G1029607
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 2736864 ~ 2738913 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1172415
tgtagtagaccttacagtgaaatgctgaatacaacaggtgtagtagaccttacagggaaatgctgaatacaacaggtgtagtagaccttacaaggaaatgctgaatacaacaggtgtagtagaccttagagtgaaatgctgaatacaacaggtgtagtagaccttacagtgaaatgctgaatacaacaggtgtagtagaccttacagtgaaatgctgaatacaacaggtgtagtagaccttacagtgaaatgctgaatacaacaggtgtagtagacctcacagtgaaatgctgaatacaacaggtgtagtagaacttacagtgaaatgcttaatacaacaggtgtagtagacctcacagtgaaatgctgaatacaacaggtgtagtagaccttacagtgaaatgctgaatacaacaggtgtagtagaccttacagtgaaatgctgaatacaacaggtgtagtagaccttacagtgaaatgctgaatacaacaggtgtagtagaacttacagtgaaatgctgaatacaaca

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1172415 True 530 lncRNA 0.39 2 2736864 2738913
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118937614 NA coding upstream 19870 2686828 ~ 2716994 (+)
LOC110517257 tcf4 coding upstream 1174043 1152988 ~ 1562821 (+)
LOC110536893 txnl1 coding upstream 1791678 917211 ~ 945186 (+)
katnal2 katnal2 coding upstream 2376413 339376 ~ 360451 (+)
sigmar1 sigmar1 coding upstream 2401268 324934 ~ 335596 (+)
il11ra LOC106568611 coding downstream 356621 3095534 ~ 3206784 (+)
LOC118937617 NA coding downstream 882483 3621059 ~ 3622127 (+)
LOC110536763 LOC106572512 coding downstream 1397407 4136320 ~ 4226240 (+)
LOC118937874 NA coding downstream 1829172 4568083 ~ 4569025 (+)
LOC110536864 LOC106568580 coding downstream 1839540 4578453 ~ 4797837 (+)
G1029565 NA non-coding upstream 71345 2665138 ~ 2665519 (+)
G1029533 NA non-coding upstream 118945 2617517 ~ 2617919 (+)
G1029521 NA non-coding upstream 139604 2596834 ~ 2597260 (+)
G1029499 NA non-coding upstream 173813 2562717 ~ 2563051 (+)
G1029492 NA non-coding upstream 179231 2553388 ~ 2557633 (+)
G1029609 NA non-coding downstream 5243 2744156 ~ 2780013 (+)
G1029586 NA non-coding downstream 44604 2783517 ~ 2786006 (+)
G1029627 NA non-coding downstream 63753 2802666 ~ 2803265 (+)
G1029629 NA non-coding downstream 66230 2805143 ~ 2805845 (+)
G1029637 NA non-coding downstream 78055 2816968 ~ 2818816 (+)
G1029570 NA other upstream 66357 2669904 ~ 2670507 (+)
G1029386 NA other upstream 292367 2443531 ~ 2444497 (+)
G1029035 NA other upstream 849270 1887147 ~ 1887594 (+)
G1028573 NA other upstream 1022290 1712531 ~ 1714574 (+)
G1029628 NA other downstream 64576 2803489 ~ 2804024 (+)
G1030609 NA other downstream 1083188 3822101 ~ 3822569 (+)
G1031335 NA other downstream 1936593 4675506 ~ 4677242 (+)
LOC110536873 inip other downstream 2178630 4917485 ~ 4965917 (+)

Expression


G1029607 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1029607 Expression in each Bioproject

Bar chart with 16 bars.
G1029607 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network