G1029703



Basic Information


Item Value
gene id G1029703
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 2952249 ~ 2954072 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1172555
CAGGAACTCATTACAACAGATAGCAGAAACTCATTAGAACAGATAGCAGAAACTCATTATAACAGACAGCAGGAACTCATTACAACAGACAGCAGGAACTCATTACAACAGACAGCAGGAACTCATCATAACAGATAGCAGGAACTCATTATAACAGACAGCAGGAACTCGTTACAACAGACAGCAGAAACTCATTATAACAGACAGCAGAAACTCATTATAACAGACAGCAGGAACTCATTACAACAGACAGCAGGAACTCATTATAACAGACAACAGAAACTCATTATAACAGACAGCAGGAACTCATTATAACAGACAGCAGGAAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1172555 True 329 lncRNA 0.39 2 2952249 2954072
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118937614 NA coding upstream 235255 2686828 ~ 2716994 (+)
LOC110517257 tcf4 coding upstream 1389428 1152988 ~ 1562821 (+)
LOC110536893 txnl1 coding upstream 2007063 917211 ~ 945186 (+)
katnal2 katnal2 coding upstream 2591798 339376 ~ 360451 (+)
sigmar1 sigmar1 coding upstream 2616653 324934 ~ 335596 (+)
il11ra LOC106568611 coding downstream 141462 3095534 ~ 3206784 (+)
LOC118937617 NA coding downstream 667324 3621059 ~ 3622127 (+)
LOC110536763 LOC106572512 coding downstream 1182248 4136320 ~ 4226240 (+)
LOC118937874 NA coding downstream 1614013 4568083 ~ 4569025 (+)
LOC110536864 LOC106568580 coding downstream 1624381 4578453 ~ 4797837 (+)
G1029681 NA non-coding upstream 34269 2917579 ~ 2917980 (+)
G1029676 NA non-coding upstream 49503 2901185 ~ 2902746 (+)
G1029671 NA non-coding upstream 59601 2891751 ~ 2892648 (+)
G1029653 NA non-coding upstream 89415 2861471 ~ 2862834 (+)
G1029649 NA non-coding upstream 96586 2853872 ~ 2855663 (+)
G1029715 NA non-coding downstream 20336 2974408 ~ 2974809 (+)
G1029752 NA non-coding downstream 91860 3045932 ~ 3046256 (+)
G1029480 NA non-coding downstream 94053 3048125 ~ 3051090 (+)
G1029777 NA non-coding downstream 151488 3105560 ~ 3106930 (+)
G1029779 NA non-coding downstream 157197 3111269 ~ 3111804 (+)
G1029628 NA other upstream 148225 2803489 ~ 2804024 (+)
G1029570 NA other upstream 281742 2669904 ~ 2670507 (+)
G1029386 NA other upstream 507752 2443531 ~ 2444497 (+)
G1029035 NA other upstream 1064655 1887147 ~ 1887594 (+)
G1028573 NA other upstream 1237675 1712531 ~ 1714574 (+)
G1030609 NA other downstream 868029 3822101 ~ 3822569 (+)
G1031335 NA other downstream 1721434 4675506 ~ 4677242 (+)
LOC110536873 inip other downstream 1963471 4917485 ~ 4965917 (+)
G1031481 NA other downstream 2184043 5138115 ~ 5140739 (+)

Expression


G1029703 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1029703 Expression in each Bioproject

Bar chart with 8 bars.
G1029703 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network