G1030609


Basic Information

Item Value
gene id G1030609
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 3822101 ~ 3822569 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1173659
ATATGATTAAGATGAATATGTAGAAAGGAAAGCAGTGCATTGATTTTCTCTGACTACCGACATCACCTGTGAGTGTGAATGAAATGTAGGGAGGATATAACCACATTCCTTTTACAGCTGACTCTCATTCAGTGATATAACACTGTGAAAATAAACGGAGACATGTTGACAAGAGATTATCCATGGACACTGGTACTGTAAGGGGTAAAGACTGGTTCTCCATGGACACTGGTACTGTAAGGGGTAAAGACTGGTTCTCCATGGACACTGGTACTGTAAGGGGTAAAGACTGGTTCTCCATGGAAACTGGTACTGTAAGGGATAAAGACTGGTTATCAATGGACACTGGTATTGTAAGGGGTAAAGACTGGTTCTCCATGGACACTGGTACTGTAATTGGTAAAGACTGGTTCTCCATGGACACTGGTACTGTAAGGGATAAAGACTGGTTATCAATGGACACTGGTAT

Function

NR:

description
PREDICTED: NF-kappa-B essential modulator-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1173659 True 469 TUCP 0.42 1 3822101 3822569
Loading

Neighbor

gene id symbol gene type direction distance location
LOC118937617 NA coding upstream 199974 3621059 ~ 3622127 (+)
il11ra LOC106568611 coding upstream 615317 3095534 ~ 3206784 (+)
cntfr cntfr coding upstream 774370 2532584 ~ 3047731 (+)
LOC118937614 NA coding upstream 1105107 2686828 ~ 2716994 (+)
LOC110517257 tcf4 coding upstream 2259280 1152988 ~ 1562821 (+)
LOC110536763 LOC106572512 coding downstream 313751 4136320 ~ 4226240 (+)
LOC118937874 NA coding downstream 745516 4568083 ~ 4569025 (+)
LOC110536864 LOC106568580 coding downstream 755884 4578453 ~ 4797837 (+)
LOC110536765 NA coding downstream 981598 4804167 ~ 4806183 (+)
LOC110536865 LOC106572882 coding downstream 1007763 4830332 ~ 4846470 (+)
G1030607 NA non-coding upstream 379 3821437 ~ 3821722 (+)
G1030597 NA non-coding upstream 30641 3791118 ~ 3791460 (+)
G1030576 NA non-coding upstream 50407 3771057 ~ 3771694 (+)
G1030473 NA non-coding upstream 64420 3746610 ~ 3757681 (+)
G1030448 NA non-coding upstream 127814 3690886 ~ 3694287 (+)
G1030616 NA non-coding downstream 8684 3831253 ~ 3831764 (+)
G1030626 NA non-coding downstream 18126 3840695 ~ 3840975 (+)
G1030640 NA non-coding downstream 34229 3856798 ~ 3857062 (+)
G1030688 NA non-coding downstream 81664 3904233 ~ 3974683 (+)
G1030704 NA non-coding downstream 117762 3940331 ~ 3941158 (+)
G1029628 NA other upstream 1018077 2803489 ~ 2804024 (+)
G1029570 NA other upstream 1151594 2669904 ~ 2670507 (+)
G1029386 NA other upstream 1377604 2443531 ~ 2444497 (+)
G1029035 NA other upstream 1934507 1887147 ~ 1887594 (+)
G1028573 NA other upstream 2107527 1712531 ~ 1714574 (+)
G1031335 NA other downstream 852937 4675506 ~ 4677242 (+)
LOC110536873 inip other downstream 1094974 4917485 ~ 4965917 (+)
G1031481 NA other downstream 1315546 5138115 ~ 5140739 (+)
G1031527 LOC106568567 other downstream 1445261 5267830 ~ 5280550 (+)

Expression

G1030609 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1030609 Expression in each Bioproject

Bar chart with 3 bars.
G1030609 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network