G1034355



Basic Information


Item Value
gene id G1034355
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 7556367 ~ 7556806 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1178432
gctatatacagggagtaccagggaataacatggctatatacaggaagtaccagttaataacatggctatatacaggaagtaccaggtaataacatggctatatacaggaagtaccaggtaataacatggctatacacaagtaccaggtagtaacatggctgtatacagggagtaccaggtagtaacatggctatatacaggaagtaccaggtagtaacatggctgtatacagggagtaccaggtagtaacatggatatatacaggaagtaccaggtaataacatggctttttcagggagtaccaggtaataacatggctgtatacaggaagtaccaggtaataa

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1178432 True 344 lncRNA 0.40 2 7556367 7556806
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110536886 tcf4 coding downstream 140551 7403125 ~ 7415816 (-)
LOC110536888 LOC106568538 coding downstream 179434 7311685 ~ 7376933 (-)
LOC110536889 NA coding downstream 247871 7307620 ~ 7309017 (-)
wdr91 wdr91 coding downstream 374034 7147134 ~ 7182333 (-)
mbd2 LOC105008486 coding downstream 425216 7027102 ~ 7131151 (-)
LOC110536901 LOC106568527 coding upstream 50151 7606957 ~ 7613335 (-)
LOC110523118 LOC106572051 coding upstream 90749 7645369 ~ 7821518 (-)
stbd1 stbd1 coding upstream 280801 7837607 ~ 7851608 (-)
LOC101268972 LOC101448022 coding upstream 342820 7898867 ~ 7900915 (-)
LOC110536909 LOC106568505 coding upstream 422037 7978843 ~ 7981203 (-)
G1033655 NA non-coding downstream 72848 7483305 ~ 7483519 (-)
G1033648 NA non-coding downstream 103001 7453145 ~ 7453366 (-)
G1033611 NA non-coding downstream 158484 7396901 ~ 7397883 (-)
G1033639 NA non-coding downstream 164049 7389445 ~ 7392318 (-)
G1033638 NA non-coding downstream 166171 7389893 ~ 7390196 (-)
G1034350 LOC106568525 non-coding upstream 69038 7625844 ~ 7638033 (-)
G1034384 NA non-coding upstream 76900 7633706 ~ 7635412 (-)
G1034385 NA non-coding upstream 84919 7641725 ~ 7642997 (-)
G1034387 NA non-coding upstream 86650 7643456 ~ 7643941 (-)
G1032941 NA other downstream 1356033 6197017 ~ 6200334 (-)
G1032314 NA other downstream 1773003 5782940 ~ 5783364 (-)
LOC110536877 mob3b other downstream 2011859 5538381 ~ 5607736 (-)
G1032158 NA other downstream 2018755 5535481 ~ 5537612 (-)
G1031871 slc46a2 other downstream 2724913 4830370 ~ 4831454 (-)
G1034443 yo84 other upstream 271074 7827880 ~ 7834578 (-)
G1034667 NA other upstream 722533 8279339 ~ 8279866 (-)
G1035160 NA other upstream 1279450 8836256 ~ 8838834 (-)
hcn1 hcn1 other upstream 1461701 9018507 ~ 9206417 (-)

Expression


G1034355 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G1034355 Expression in each Bioproject

Bar chart with 15 bars.
G1034355 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network