G1034566



Basic Information


Item Value
gene id G1034566
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 8039255 ~ 8039590 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1178740
gacagcaacacagagttacacatggagtaaacaataaacaagtcaataacacagtagaaaaaaggggagtctatatacattgtgtgcaaaaggcatgaggaggtaggcgaataattacaatttagcagattaacactggagtgataaattatcagatggtcatgtgcaggtagagatactggtgtgcaaaagagcagaaaagtaaataaataaaaacagtatggggatgaggtaggtaaattgggtgggctatttaccgatggactatgtacagctgcagcgatcggttagctgctcagatagcagatgtttgaagttggtgagggagataaaagt

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1178740 True 336 lncRNA 0.40 1 8039255 8039590
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110536909 LOC106568505 coding downstream 58052 7978843 ~ 7981203 (-)
LOC101268972 LOC101448022 coding downstream 138340 7898867 ~ 7900915 (-)
stbd1 stbd1 coding downstream 187647 7837607 ~ 7851608 (-)
LOC110523118 LOC106572051 coding downstream 217737 7645369 ~ 7821518 (-)
LOC110536901 LOC106568527 coding downstream 425920 7606957 ~ 7613335 (-)
LOC110536914 LOC106568507 coding upstream 88258 8127848 ~ 8205393 (-)
LOC100136343 LOC100136343 coding upstream 206420 8246010 ~ 8252914 (-)
LOC118937621 NA coding upstream 238951 8278541 ~ 8288538 (-)
ptpn13 ptpn13 coding upstream 251961 8291551 ~ 8460671 (-)
arhgap24 arhgap24 coding upstream 554739 8594329 ~ 8809553 (-)
G1034564 NA non-coding downstream 5024 8033937 ~ 8034231 (-)
G1034563 NA non-coding downstream 5765 8033184 ~ 8033490 (-)
G1034557 sdad1 non-coding downstream 20649 8011959 ~ 8018606 (-)
G1034551 NA non-coding downstream 46630 7992414 ~ 7992625 (-)
G1034547 NA non-coding downstream 55438 7983543 ~ 7983817 (-)
G1034592 NA non-coding upstream 34080 8073670 ~ 8073940 (-)
G1034561 NA non-coding upstream 60099 8099689 ~ 8100359 (-)
G1034614 NA non-coding upstream 83691 8123281 ~ 8124156 (-)
G1034610 NA non-coding upstream 186328 8225918 ~ 8226507 (-)
G1034644 NA non-coding upstream 191686 8231276 ~ 8232542 (-)
G1034443 yo84 other downstream 204677 7827880 ~ 7834578 (-)
G1032941 NA other downstream 1838921 6197017 ~ 6200334 (-)
G1032314 NA other downstream 2255891 5782940 ~ 5783364 (-)
LOC110536877 mob3b other downstream 2494747 5538381 ~ 5607736 (-)
G1034667 NA other upstream 239749 8279339 ~ 8279866 (-)
G1035160 NA other upstream 796666 8836256 ~ 8838834 (-)
hcn1 hcn1 other upstream 978917 9018507 ~ 9206417 (-)
G1035717 NA other upstream 1493910 9533500 ~ 9548135 (-)
LOC110536932 NA other upstream 1646439 9684834 ~ 9696461 (-)

Expression


G1034566 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G1034566 Expression in each Bioproject

Bar chart with 19 bars.
G1034566 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network