G1034644



Basic Information


Item Value
gene id G1034644
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 8231276 ~ 8232542 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1178830
atctatctatctataggtaacagggttgatgtgttattctagcctgtctatctataggtaacagggttgatgtgttattctagcctgtctatctataggtaacagggttgatgtgttattctagcctgtctatctataggtaacagggttgatgtgttattctagcctgtctatctataggtaacagggttgatgtgttattctagcctgtctatctataggtaacagggtcgatgtgttattctagcctgtctatctataggtaacagggtcgatgtgttattctagcctgtctatctataggtaacagggttgatgtgttattctagcctgtctatctataggtaacagggttga

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1178830 True 357 lncRNA 0.39 2 8231276 8232542

Neighbor


gene id symbol gene type direction distance location
LOC110536914 LOC106568507 coding downstream 25883 8127848 ~ 8205393 (-)
LOC110536909 LOC106568505 coding downstream 250073 7978843 ~ 7981203 (-)
LOC101268972 LOC101448022 coding downstream 330361 7898867 ~ 7900915 (-)
stbd1 stbd1 coding downstream 379668 7837607 ~ 7851608 (-)
LOC110523118 LOC106572051 coding downstream 409758 7645369 ~ 7821518 (-)
LOC100136343 LOC100136343 coding upstream 13468 8246010 ~ 8252914 (-)
LOC118937621 NA coding upstream 45999 8278541 ~ 8288538 (-)
ptpn13 ptpn13 coding upstream 59009 8291551 ~ 8460671 (-)
arhgap24 arhgap24 coding upstream 361787 8594329 ~ 8809553 (-)
esm1 esm1 coding upstream 625089 8857631 ~ 8860067 (-)
G1034610 NA non-coding downstream 4769 8225918 ~ 8226507 (-)
G1034614 NA non-coding downstream 107120 8123281 ~ 8124156 (-)
G1034561 NA non-coding downstream 130917 8099689 ~ 8100359 (-)
G1034592 NA non-coding downstream 157336 8073670 ~ 8073940 (-)
G1034566 NA non-coding downstream 191686 8039255 ~ 8039590 (-)
G1034649 NA non-coding upstream 11121 8243663 ~ 8244337 (-)
G1034655 NA non-coding upstream 23250 8255792 ~ 8257078 (-)
G1034654 NA non-coding upstream 23684 8256226 ~ 8256848 (-)
G1034522 NA non-coding upstream 74485 8307027 ~ 8307650 (-)
G1034696 NA non-coding upstream 132504 8365046 ~ 8369169 (-)
G1034443 yo84 other downstream 396698 7827880 ~ 7834578 (-)
G1032941 NA other downstream 2030942 6197017 ~ 6200334 (-)
G1032314 NA other downstream 2447912 5782940 ~ 5783364 (-)
LOC110536877 mob3b other downstream 2686768 5538381 ~ 5607736 (-)
G1034667 NA other upstream 46797 8279339 ~ 8279866 (-)
G1035160 NA other upstream 603714 8836256 ~ 8838834 (-)
hcn1 hcn1 other upstream 785965 9018507 ~ 9206417 (-)
G1035717 NA other upstream 1300958 9533500 ~ 9548135 (-)
LOC110536932 NA other upstream 1453487 9684834 ~ 9696461 (-)

Expression


G1034644 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1034644 Expression in each Bioproject

Bar chart with 10 bars.
G1034644 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network