G1034655



Basic Information


Item Value
gene id G1034655
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 8255792 ~ 8257078 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1178845
TTCATATGAAGCTTGTTTACTGGTATCCCAGCTTACTGGATGTTTCATATGAAGCTTGTTTACTGGTGTCCCAGCTTACTGGATGTTTCATATGAAGCTTGTTTACTGGTGTCCCAGCTTACTGGATGTTTCATATGAAGCTTGTTTACTGATGTCCCAACTTACTGGATGTTTCATATGAAGCTTGTTTACTGATGTCTCCGCT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1178845 True 205 lncRNA 0.40 2 8255792 8257078
Loading

Neighbor


gene id symbol gene type direction distance location
LOC100136343 LOC100136343 coding downstream 2878 8246010 ~ 8252914 (-)
LOC110536914 LOC106568507 coding downstream 50399 8127848 ~ 8205393 (-)
LOC110536909 LOC106568505 coding downstream 274589 7978843 ~ 7981203 (-)
LOC101268972 LOC101448022 coding downstream 354877 7898867 ~ 7900915 (-)
stbd1 stbd1 coding downstream 404184 7837607 ~ 7851608 (-)
LOC118937621 NA coding upstream 21463 8278541 ~ 8288538 (-)
ptpn13 ptpn13 coding upstream 34473 8291551 ~ 8460671 (-)
arhgap24 arhgap24 coding upstream 337251 8594329 ~ 8809553 (-)
esm1 esm1 coding upstream 600553 8857631 ~ 8860067 (-)
LOC110536920 NA coding upstream 758918 9015996 ~ 9022222 (-)
G1034649 NA non-coding downstream 11455 8243663 ~ 8244337 (-)
G1034644 NA non-coding downstream 23250 8231276 ~ 8232542 (-)
G1034610 NA non-coding downstream 29285 8225918 ~ 8226507 (-)
G1034614 NA non-coding downstream 131636 8123281 ~ 8124156 (-)
G1034561 NA non-coding downstream 155433 8099689 ~ 8100359 (-)
G1034522 NA non-coding upstream 49949 8307027 ~ 8307650 (-)
G1034696 NA non-coding upstream 107968 8365046 ~ 8369169 (-)
G1034718 NA non-coding upstream 160257 8417335 ~ 8418652 (-)
G1034746 NA non-coding upstream 224838 8481916 ~ 8483916 (-)
G1034748 NA non-coding upstream 227591 8484669 ~ 8485498 (-)
G1034443 yo84 other downstream 421214 7827880 ~ 7834578 (-)
LOC110523118 LOC106572051 other downstream 473754 7645369 ~ 7821518 (-)
G1032941 NA other downstream 2055458 6197017 ~ 6200334 (-)
G1032314 NA other downstream 2472428 5782940 ~ 5783364 (-)
LOC110536877 mob3b other downstream 2711284 5538381 ~ 5607736 (-)
G1034667 NA other upstream 22261 8279339 ~ 8279866 (-)
G1035160 NA other upstream 579178 8836256 ~ 8838834 (-)
hcn1 hcn1 other upstream 761429 9018507 ~ 9206417 (-)
G1035717 NA other upstream 1276422 9533500 ~ 9548135 (-)
LOC110536932 NA other upstream 1428951 9684834 ~ 9696461 (-)

Expression


G1034655 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1034655 Expression in each Bioproject

Bar chart with 12 bars.
G1034655 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network