G1034654



Basic Information


Item Value
gene id G1034654
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 8256226 ~ 8256848 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1178843
GTTTACTGGTGTCCCAGCTTACTGGATGTTTCATATGAAGCTTGTTTACTGGTGTCCCAGCTTTACTGGATGTTTCATATGAAGCTTGTTTACTGGTGTCCCAGTTTACTGGATGTTTCATATGAAGCTTGTTTACTGGTGTCCCAGCTTACTGGATGTTTCATATGAAGCTTGTTTACTGGTGTCCCAGCTTACTGGATGTTTCATATGAAGCTTGTTTACTGGTGTCCCAGCTTACTGGATGTTTCATATGAAGCTGGTTTACTGGTGTCCCAG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1178843 True 276 lncRNA 0.42 2 8256226 8256848

Neighbor


gene id symbol gene type direction distance location
LOC100136343 LOC100136343 coding downstream 3312 8246010 ~ 8252914 (-)
LOC110536914 LOC106568507 coding downstream 50833 8127848 ~ 8205393 (-)
LOC110536909 LOC106568505 coding downstream 275023 7978843 ~ 7981203 (-)
LOC101268972 LOC101448022 coding downstream 355311 7898867 ~ 7900915 (-)
stbd1 stbd1 coding downstream 404618 7837607 ~ 7851608 (-)
LOC118937621 NA coding upstream 21693 8278541 ~ 8288538 (-)
ptpn13 ptpn13 coding upstream 34703 8291551 ~ 8460671 (-)
arhgap24 arhgap24 coding upstream 337481 8594329 ~ 8809553 (-)
esm1 esm1 coding upstream 600783 8857631 ~ 8860067 (-)
LOC110536920 NA coding upstream 759148 9015996 ~ 9022222 (-)
G1034649 NA non-coding downstream 11889 8243663 ~ 8244337 (-)
G1034644 NA non-coding downstream 23684 8231276 ~ 8232542 (-)
G1034610 NA non-coding downstream 29719 8225918 ~ 8226507 (-)
G1034614 NA non-coding downstream 132070 8123281 ~ 8124156 (-)
G1034561 NA non-coding downstream 155867 8099689 ~ 8100359 (-)
G1034522 NA non-coding upstream 50179 8307027 ~ 8307650 (-)
G1034696 NA non-coding upstream 108198 8365046 ~ 8369169 (-)
G1034718 NA non-coding upstream 160487 8417335 ~ 8418652 (-)
G1034746 NA non-coding upstream 225068 8481916 ~ 8483916 (-)
G1034748 NA non-coding upstream 227821 8484669 ~ 8485498 (-)
G1034443 yo84 other downstream 421648 7827880 ~ 7834578 (-)
LOC110523118 LOC106572051 other downstream 474188 7645369 ~ 7821518 (-)
G1032941 NA other downstream 2055892 6197017 ~ 6200334 (-)
G1032314 NA other downstream 2472862 5782940 ~ 5783364 (-)
LOC110536877 mob3b other downstream 2711718 5538381 ~ 5607736 (-)
G1034667 NA other upstream 22491 8279339 ~ 8279866 (-)
G1035160 NA other upstream 579408 8836256 ~ 8838834 (-)
hcn1 hcn1 other upstream 761659 9018507 ~ 9206417 (-)
G1035717 NA other upstream 1276652 9533500 ~ 9548135 (-)
LOC110536932 NA other upstream 1429181 9684834 ~ 9696461 (-)

Expression


G1034654 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1034654 Expression in each Bioproject

Bar chart with 14 bars.
G1034654 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.

Co-expression Network