G1034696



Basic Information


Item Value
gene id G1034696
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 8365046 ~ 8369169 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1178893
gtgggttggtactgttgtggacgtgtgttggtgggttggtactgttgtagacgtgggttggtactgttgtggatgtgtgttggtgggttggtactgttgtggaggtgggttggtactgttgtggaggtgggttggtactgttgtggacgtgggttggtactgttgtggacgtgtgttggtgggttggtactgttgtagacgtgggttggtactgttgtggacgtgtgttggtgggttggt

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1178893 True 240 lncRNA 0.53 2 8365046 8369169
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118937621 NA coding downstream 76508 8278541 ~ 8288538 (-)
LOC100136343 LOC100136343 coding downstream 112132 8246010 ~ 8252914 (-)
LOC110536914 LOC106568507 coding downstream 159653 8127848 ~ 8205393 (-)
LOC110536909 LOC106568505 coding downstream 383843 7978843 ~ 7981203 (-)
LOC101268972 LOC101448022 coding downstream 464131 7898867 ~ 7900915 (-)
arhgap24 arhgap24 coding upstream 225160 8594329 ~ 8809553 (-)
esm1 esm1 coding upstream 488462 8857631 ~ 8860067 (-)
LOC110536920 NA coding upstream 646827 9015996 ~ 9022222 (-)
hcn1 hcn1 coding upstream 668467 9018507 ~ 9206417 (-)
LOC110536926 grp coding upstream 1192934 9562103 ~ 9564000 (-)
G1034522 NA non-coding downstream 57396 8307027 ~ 8307650 (-)
G1034655 NA non-coding downstream 107968 8255792 ~ 8257078 (-)
G1034654 NA non-coding downstream 108198 8256226 ~ 8256848 (-)
G1034649 NA non-coding downstream 120709 8243663 ~ 8244337 (-)
G1034644 NA non-coding downstream 132504 8231276 ~ 8232542 (-)
G1034718 NA non-coding upstream 48166 8417335 ~ 8418652 (-)
G1034746 NA non-coding upstream 112747 8481916 ~ 8483916 (-)
G1034748 NA non-coding upstream 115500 8484669 ~ 8485498 (-)
G1034751 NA non-coding upstream 118659 8487828 ~ 8489253 (-)
G1034777 NA non-coding upstream 163522 8532691 ~ 8587965 (-)
G1034667 NA other downstream 85180 8279339 ~ 8279866 (-)
G1034443 yo84 other downstream 530468 7827880 ~ 7834578 (-)
LOC110523118 LOC106572051 other downstream 583008 7645369 ~ 7821518 (-)
G1032941 NA other downstream 2164712 6197017 ~ 6200334 (-)
G1032314 NA other downstream 2581682 5782940 ~ 5783364 (-)
G1035160 NA other upstream 467087 8836256 ~ 8838834 (-)
G1035717 NA other upstream 1164331 9533500 ~ 9548135 (-)
LOC110536932 NA other upstream 1316860 9684834 ~ 9696461 (-)
sema4d sema4d other upstream 1536135 9901109 ~ 9983793 (-)

Expression


G1034696 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 125.
End of interactive chart.

G1034696 Expression in each Bioproject

Bar chart with 11 bars.
G1034696 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network