G1034781



Basic Information


Item Value
gene id G1034781
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 8537784 ~ 8539377 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1178993
GATACAGCCATGCTGTTCTGAGACAGGCTATTCAGTGGGGATACAGCCATGCTGTTCTGAGACAGGCTATTCAGTGGGGATACAGCCATGCTGTTCTGAGACAGGTTATTCAGTGGGGATACAGCCATGCTGTTCTGAGACAGGCTATTCAGTGGGGATACAACCATGCTGTTCTGAGACAGGCTATTCAGTGGGGATACAGCCATGCTGTTCTGAGACAGGCTATTCAGTGGGGATACAGCCATGCTGTTCTGAGACAGGCTATTCAGTGGGGATACAGCCATGCTGTTCTGAGACAGGCTATTCAGTGGGGATACAGCCATGCTGTTCTGAGACAGGTTACTCAGTGGGGATACAGCCATGCTGTTCTGAGACAGGTTACTCAGTGGAGATAC

Function


NR:

description
maternal embryonic leucine zipper kinase-like, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1178993 True 395 lncRNA 0.50 2 8537784 8539377
Loading

Neighbor


gene id symbol gene type direction distance location
ptpn13 ptpn13 coding downstream 77113 8291551 ~ 8460671 (-)
LOC118937621 NA coding downstream 249246 8278541 ~ 8288538 (-)
LOC100136343 LOC100136343 coding downstream 284870 8246010 ~ 8252914 (-)
LOC110536914 LOC106568507 coding downstream 332391 8127848 ~ 8205393 (-)
LOC110536909 LOC106568505 coding downstream 556581 7978843 ~ 7981203 (-)
arhgap24 arhgap24 coding upstream 54952 8594329 ~ 8809553 (-)
esm1 esm1 coding upstream 318254 8857631 ~ 8860067 (-)
LOC110536920 NA coding upstream 476619 9015996 ~ 9022222 (-)
hcn1 hcn1 coding upstream 498259 9018507 ~ 9206417 (-)
LOC110536926 grp coding upstream 1022726 9562103 ~ 9564000 (-)
G1034751 NA non-coding downstream 48531 8487828 ~ 8489253 (-)
G1034748 NA non-coding downstream 52286 8484669 ~ 8485498 (-)
G1034746 NA non-coding downstream 53868 8481916 ~ 8483916 (-)
G1034718 NA non-coding downstream 119132 8417335 ~ 8418652 (-)
G1034696 NA non-coding downstream 168615 8365046 ~ 8369169 (-)
G1034793 NA non-coding upstream 16537 8555914 ~ 8558422 (-)
G1034782 NA non-coding upstream 43975 8583352 ~ 8586439 (-)
G1034829 NA non-coding upstream 78924 8618301 ~ 8618847 (-)
G1034867 NA non-coding upstream 150100 8689477 ~ 8690390 (-)
G1034866 NA non-coding upstream 151188 8690565 ~ 8691321 (-)
G1034667 NA other downstream 257918 8279339 ~ 8279866 (-)
G1034443 yo84 other downstream 703206 7827880 ~ 7834578 (-)
LOC110523118 LOC106572051 other downstream 755746 7645369 ~ 7821518 (-)
G1032941 NA other downstream 2337450 6197017 ~ 6200334 (-)
G1032314 NA other downstream 2754420 5782940 ~ 5783364 (-)
G1035160 NA other upstream 296879 8836256 ~ 8838834 (-)
G1035717 NA other upstream 994123 9533500 ~ 9548135 (-)
LOC110536932 NA other upstream 1146652 9684834 ~ 9696461 (-)
sema4d sema4d other upstream 1365927 9901109 ~ 9983793 (-)

Expression


G1034781 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1034781 Expression in each Bioproject

Bar chart with 5 bars.
G1034781 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network