G1034911



Basic Information


Item Value
gene id G1034911
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 8776974 ~ 8782302 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1179162
ggaacactatagttacagtaatagaacactatagttacagtaatagaacactatagttacagtaatagaacactatagttacagtaatagaacactatagttacagtaatagaacactatagttacagtaacagaacactatagttacagtaatagaacactatagttacagtaatagaacactatagttacagtaatagaacactatagttacagtaatagaac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1179162 True 225 lncRNA 0.28 2 8776974 8782302
Loading

Neighbor


gene id symbol gene type direction distance location
ptpn13 ptpn13 coding downstream 316303 8291551 ~ 8460671 (-)
LOC118937621 NA coding downstream 488436 8278541 ~ 8288538 (-)
LOC100136343 LOC100136343 coding downstream 524060 8246010 ~ 8252914 (-)
LOC110536914 LOC106568507 coding downstream 571581 8127848 ~ 8205393 (-)
LOC110536909 LOC106568505 coding downstream 795771 7978843 ~ 7981203 (-)
esm1 esm1 coding upstream 75329 8857631 ~ 8860067 (-)
LOC110536920 NA coding upstream 233694 9015996 ~ 9022222 (-)
hcn1 hcn1 coding upstream 255334 9018507 ~ 9206417 (-)
LOC110536926 grp coding upstream 779801 9562103 ~ 9564000 (-)
LOC110536932 NA coding upstream 903987 9684834 ~ 9696461 (-)
G1034895 NA non-coding downstream 34422 8742184 ~ 8742552 (-)
G1034866 NA non-coding downstream 85653 8690565 ~ 8691321 (-)
G1034867 NA non-coding downstream 86584 8689477 ~ 8690390 (-)
G1034829 NA non-coding downstream 158127 8618301 ~ 8618847 (-)
G1034782 NA non-coding downstream 190535 8583352 ~ 8586439 (-)
G1034923 NA non-coding upstream 23879 8806181 ~ 8806390 (-)
G1034926 NA non-coding upstream 27570 8809872 ~ 8810077 (-)
G1034931 NA non-coding upstream 30279 8812581 ~ 8812798 (-)
G1034935 NA non-coding upstream 31398 8813700 ~ 8813924 (-)
G1034936 NA non-coding upstream 31772 8814074 ~ 8814302 (-)
G1034667 NA other downstream 497108 8279339 ~ 8279866 (-)
G1034443 yo84 other downstream 942396 7827880 ~ 7834578 (-)
LOC110523118 LOC106572051 other downstream 994936 7645369 ~ 7821518 (-)
G1032941 NA other downstream 2576640 6197017 ~ 6200334 (-)
G1032314 NA other downstream 2993610 5782940 ~ 5783364 (-)
G1035160 NA other upstream 53954 8836256 ~ 8838834 (-)
G1035717 NA other upstream 751198 9533500 ~ 9548135 (-)
sema4d sema4d other upstream 1123002 9901109 ~ 9983793 (-)

Expression


G1034911 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1034911 Expression in each Bioproject

Bar chart with 13 bars.
G1034911 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network