G1035160



Basic Information


Item Value
gene id G1035160
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 8836256 ~ 8838834 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1179454
cggtacagagtcaatgtggaggctatatacaggtggtaccggtacagagtcaatgtggaggatatatacaggtggtaccggtacagagtcaatgtggaggctatatacaggtggtaccggtacagagtcaatgtggaggatatatacaggtggtaccggtacagagtcaatgtggaggctatatacaggtggtaccggtacagagtcaatgtggaggatatatacaggtggtaccggtacagagtcaatgtggaggctatatacagggggtaccggtacagagtcaatgtggaggctatatacagggggtaccggtacagagtcaatgtggaggctatatacaggtggtaccagtacagagtcaatgtggaggctatatacaggtggtaccggtacagagtcaatgtggaggctatatacagggggtaccggtacagagtcaatgtggaggctatatacagggggta

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1179454 True 467 TUCP 0.49 2 8836256 8838834

Neighbor


gene id symbol gene type direction distance location
arhgap24 arhgap24 coding downstream 26703 8594329 ~ 8809553 (-)
ptpn13 ptpn13 coding downstream 375585 8291551 ~ 8460671 (-)
LOC118937621 NA coding downstream 547718 8278541 ~ 8288538 (-)
LOC100136343 LOC100136343 coding downstream 583342 8246010 ~ 8252914 (-)
LOC110536914 LOC106568507 coding downstream 630863 8127848 ~ 8205393 (-)
esm1 esm1 coding upstream 18797 8857631 ~ 8860067 (-)
LOC110536920 NA coding upstream 177162 9015996 ~ 9022222 (-)
hcn1 hcn1 coding upstream 198802 9018507 ~ 9206417 (-)
LOC110536926 grp coding upstream 723269 9562103 ~ 9564000 (-)
LOC110536932 NA coding upstream 847455 9684834 ~ 9696461 (-)
G1035158 NA non-coding downstream 899 8835122 ~ 8835357 (-)
G1034963 NA non-coding downstream 4065 8831648 ~ 8832191 (-)
G1034953 NA non-coding downstream 10773 8825159 ~ 8825483 (-)
G1034947 NA non-coding downstream 15553 8820214 ~ 8820703 (-)
G1034936 NA non-coding downstream 21954 8814074 ~ 8814302 (-)
G1035167 NA non-coding upstream 10220 8849054 ~ 8850091 (-)
G1035168 NA non-coding upstream 13032 8851866 ~ 8852257 (-)
G1035170 NA non-coding upstream 24279 8863113 ~ 8865691 (-)
G1035180 NA non-coding upstream 44727 8883561 ~ 8884749 (-)
G1035245 NA non-coding upstream 139013 8977847 ~ 8978047 (-)
G1034667 NA other downstream 556390 8279339 ~ 8279866 (-)
G1034443 yo84 other downstream 1001678 7827880 ~ 7834578 (-)
LOC110523118 LOC106572051 other downstream 1054218 7645369 ~ 7821518 (-)
G1032941 NA other downstream 2635922 6197017 ~ 6200334 (-)
G1032314 NA other downstream 3052892 5782940 ~ 5783364 (-)
G1035717 NA other upstream 694666 9533500 ~ 9548135 (-)
sema4d sema4d other upstream 1066470 9901109 ~ 9983793 (-)
LOC110536951 cr032 other upstream 2011368 10850171 ~ 10860150 (-)

Expression


G1035160 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1035160 Expression in each Bioproject

Bar chart with 17 bars.
G1035160 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network