G1035168



Basic Information


Item Value
gene id G1035168
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 8851866 ~ 8852257 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1179462
tgtgtaacggtcttctaggtgtgaaggagagtcggaccaaaatgcggcgtgtagattgcgatccatgtttattgtgactataacaacatgaatccaaatacaaacagtgcaaaataataaacgtaatgaaaaccgaaacagcctaaactggtgcaaactaacactaaggacaatcacccacaaacacacagtgaaacccaggctacctaaatatggttcccaatcagagacaatgactaacacctgcctctgattgagaaccatatcaggccggacatagaaatagacaaacaagacatccaacatagaatgcccacccagttcacgtcctgaccaacactaaaacaaggaaaacacacacgaacgatggtcagaacgtgacagtacccccc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1179462 True 392 lncRNA 0.43 1 8851866 8852257

Neighbor


gene id symbol gene type direction distance location
arhgap24 arhgap24 coding downstream 42313 8594329 ~ 8809553 (-)
ptpn13 ptpn13 coding downstream 391195 8291551 ~ 8460671 (-)
LOC118937621 NA coding downstream 563328 8278541 ~ 8288538 (-)
LOC100136343 LOC100136343 coding downstream 598952 8246010 ~ 8252914 (-)
LOC110536914 LOC106568507 coding downstream 646473 8127848 ~ 8205393 (-)
esm1 esm1 coding upstream 5374 8857631 ~ 8860067 (-)
LOC110536920 NA coding upstream 163739 9015996 ~ 9022222 (-)
hcn1 hcn1 coding upstream 185379 9018507 ~ 9206417 (-)
LOC110536926 grp coding upstream 709846 9562103 ~ 9564000 (-)
LOC110536932 NA coding upstream 834032 9684834 ~ 9696461 (-)
G1035167 NA non-coding downstream 1775 8849054 ~ 8850091 (-)
G1035158 NA non-coding downstream 16509 8835122 ~ 8835357 (-)
G1034963 NA non-coding downstream 19675 8831648 ~ 8832191 (-)
G1034953 NA non-coding downstream 26383 8825159 ~ 8825483 (-)
G1034947 NA non-coding downstream 31163 8820214 ~ 8820703 (-)
G1035170 NA non-coding upstream 10856 8863113 ~ 8865691 (-)
G1035180 NA non-coding upstream 31304 8883561 ~ 8884749 (-)
G1035245 NA non-coding upstream 125590 8977847 ~ 8978047 (-)
G1035246 NA non-coding upstream 125907 8978164 ~ 8978380 (-)
G1035160 NA other downstream 13032 8836256 ~ 8838834 (-)
G1034667 NA other downstream 572000 8279339 ~ 8279866 (-)
G1034443 yo84 other downstream 1017288 7827880 ~ 7834578 (-)
LOC110523118 LOC106572051 other downstream 1069828 7645369 ~ 7821518 (-)
G1032941 NA other downstream 2651532 6197017 ~ 6200334 (-)
G1035717 NA other upstream 681243 9533500 ~ 9548135 (-)
sema4d sema4d other upstream 1053047 9901109 ~ 9983793 (-)
LOC110536951 cr032 other upstream 1997945 10850171 ~ 10860150 (-)

Expression


G1035168 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G1035168 Expression in each Bioproject

Bar chart with 18 bars.
G1035168 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network