G1035014



Basic Information


Item Value
gene id G1035014
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 8954793 ~ 8955237 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1179276
CCCAGATGTATATCTTATTCCTATTGGCTCCCAGATGTATATCTTATTCCTATTGGCCCCCAGATGTATATCTTATTCCTATTGGCTCCCAGATGTATATCTTATTCCTATTGGCTCCCAGATGTATATCTTATTCCTATTGGCCCCCAGATGTATATCTTATTCCTATTGGCTCCCAGATTTATATCTTATTCCTATTGGCTCCCAGATGTATATCTTATTCCTATTGGCTCCCAGATGTATATCTTATTCCTATTGGCCCCCAGATTTATATCTTATTCCTATTGGCTCCCAGATTTATATCTTATTCCTATTGGCTCCCAGATGTATATCTTATTCCTATTGCCATTGGATCTCTGTCAGCTTCGGTCAACGGTTACCTATGTG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1179276 True 387 TUCP 0.39 2 8954793 8955237

Neighbor


gene id symbol gene type direction distance location
LOC118937876 NA coding upstream 125413 8826581 ~ 8829380 (+)
mapk10 mapk10 coding upstream 368350 8472046 ~ 8586443 (+)
LOC110536916 LOC106568505 coding upstream 663676 8288572 ~ 8291117 (+)
LOC110536912 LOC106568508 coding upstream 831702 8072971 ~ 8123091 (+)
LOC110536911 LOC106568509 coding upstream 890788 8041387 ~ 8064005 (+)
ccbe1 ccbe1 coding downstream 393942 9349179 ~ 9459891 (+)
lman1 lman1 coding downstream 540337 9495574 ~ 9523645 (+)
cplx4a cplx4 coding downstream 577889 9533126 ~ 9548216 (+)
rx3 rax coding downstream 595727 9550964 ~ 9555427 (+)
znf532 znf532 coding downstream 621799 9577036 ~ 9615206 (+)
G1034982 NA non-coding upstream 89036 8863085 ~ 8865757 (+)
G1034981 NA non-coding upstream 92225 8862324 ~ 8862568 (+)
G1034975 NA non-coding upstream 109789 8844733 ~ 8845004 (+)
G1034971 NA non-coding upstream 114255 8840253 ~ 8840538 (+)
G1034954 NA non-coding upstream 128854 8825676 ~ 8825939 (+)
G1035023 NA non-coding downstream 19467 8974704 ~ 8974910 (+)
G1035024 NA non-coding downstream 22725 8977962 ~ 8978179 (+)
G1035025 NA non-coding downstream 24763 8980000 ~ 8980578 (+)
G1035038 NA non-coding downstream 47636 9002873 ~ 9003389 (+)
G1035060 NA non-coding downstream 92317 9047554 ~ 9049052 (+)
G1034024 NA other upstream 690503 8262161 ~ 8264290 (+)
G1033822 stbd1 other upstream 1103242 7837686 ~ 7851551 (+)
G1033821 yo84 other upstream 1120417 7827978 ~ 7834376 (+)
G1033752 LOC106568522 other upstream 1306566 7647649 ~ 7648227 (+)
G1033419 NA other upstream 1600789 7353631 ~ 7354004 (+)
G1035405 NA other downstream 295684 9250921 ~ 9251578 (+)
G1035825 nedd4l other downstream 808010 9763247 ~ 9764989 (+)
G1035997 sema4d other downstream 951908 9907145 ~ 9910373 (+)
G1036179 NA other downstream 1230479 10185716 ~ 10186413 (+)

Expression


G1035014 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.
End of interactive chart.

G1035014 Expression in each Bioproject

Bar chart with 11 bars.
G1035014 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network