G1039331



Basic Information


Item Value
gene id G1039331
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 13017294 ~ 13017548 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1184424
CAGTCAGGCAGGTTTCAGAACAGCCAAATGAAAGGTAAGCATGGACAATTGTGTCAGTCAGGCAGGTTTCAGAACAGCCAAATGAAAGGTAAGCATGGACAATTGTGTCAGTCAGGCAGGTTTCAGAACAGCCAAATGAAAGGTAAGCATGGACAATTGTGACAGTCAGGCAGGTTTCAGAACAGCCAAATGAAAGGTAAG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1184424 True 201 lncRNA 0.45 2 13017294 13017548

Neighbor


gene id symbol gene type direction distance location
trnaa-ugc-52 NA coding downstream 80273 12936948 ~ 12937021 (-)
LOC110536786 LOC106561608 coding downstream 258419 12640927 ~ 12758875 (-)
LOC118937673 NA coding downstream 467349 12547316 ~ 12549945 (-)
LOC110536785 LOC106568423 coding downstream 494655 12503059 ~ 12522639 (-)
LOC110536783 LOC106568425 coding downstream 734481 12247792 ~ 12282813 (-)
LOC110536788 rabgap1 coding upstream 63852 13081400 ~ 13255741 (-)
LOC110536985 LOC106568377 coding upstream 161175 13178723 ~ 13184969 (-)
LOC110536789 LOC106568378 coding upstream 257621 13275169 ~ 13318946 (-)
LOC110536986 LOC106568381 coding upstream 303570 13321118 ~ 13324415 (-)
LOC110536988 LOC106568382 coding upstream 318253 13335801 ~ 13354661 (-)
G1039313 NA non-coding downstream 30054 12986861 ~ 12987240 (-)
G1039297 NA non-coding downstream 59673 12950967 ~ 12957621 (-)
G1039286 NA non-coding downstream 90814 12920096 ~ 12926480 (-)
G1039004 NA non-coding downstream 173292 12842259 ~ 12844002 (-)
G1038999 NA non-coding downstream 177645 12839341 ~ 12839649 (-)
G1039338 NA non-coding upstream 18755 13036303 ~ 13038178 (-)
G1039358 NA non-coding upstream 118242 13135790 ~ 13136822 (-)
G1039365 NA non-coding upstream 132110 13149658 ~ 13150572 (-)
G1039368 NA non-coding upstream 143634 13161182 ~ 13161876 (-)
G1039372 NA non-coding upstream 151621 13169169 ~ 13173573 (-)
G1038943 NA other downstream 296140 12720501 ~ 12721154 (-)
G1038606 NA other downstream 724756 12289524 ~ 12292538 (-)
G1038295 NA other downstream 1278517 11666987 ~ 11738777 (-)
G1038258 NA other downstream 1401351 11606351 ~ 11615943 (-)
LOC110536956 LOC106568459 other downstream 1786462 11212672 ~ 11231102 (-)
G1039364 NA other upstream 130110 13147658 ~ 13176443 (-)
G1039366 NA other upstream 133473 13151021 ~ 13152307 (-)
G1039504 NA other upstream 337752 13355300 ~ 13355795 (-)
G1040300 NA other upstream 1161110 14178658 ~ 14180141 (-)

Expression


G1039331 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1039331 Expression in each Bioproject

Bar chart with 9 bars.
G1039331 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network