G1039147



Basic Information


Item Value
gene id G1039147
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 13124924 ~ 13126167 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1184224
gtttatggttaggtacacattgatgtttatggttaggtacacattggtgtttatggttaggtacacattggtgtttatggttaggtacacattggtgtttatggttaggtacacattggtgtttatggttaggtacacattggtgtttatggttaggtacatattggtgtttatggttaggtacacattggtgtttatggttaggtacacattgatgtttatggttaggtacacattggtgtttatggttaggtacacattggtgtttatggttaggtacacattggtgtttatggttaggtacatattggtgtttatggttaggtacacattggtgtttatggttaggtacacattggtgtttatggttaggtacatattggtgtttatggttaggtacatattggtgtttatggttaggtacatattggtgtttatggttaggtacacattggtgtttatggttaggtacacattgatgtttatggttaggtacacattggtgtttatggttaggtacacattggtgtttatggttaggtacacattggtgtttatggttaggtacatattggtgtttatggttaggtacacattggtgtttatggttaggtacacattgatgtttatggttaggtacacattggtgtttatggttaggtacacattgatgtttatggttaggtacatattggtgtttatggttaggtacacattggtgtttatggttaggtacatattggtgtttatggttaggtacacattggtgtttatggttaggtacacattggtgtttatggttaggtacacatgggtgtttatggttaggtacacattggtgtttatggttaggtacatattggtgtttatggttaggtacatattggtgtttatggttaggtacacattggtgtttatggttaggtacatattggtgtttatggttaggtacacattggtgtttatggttaggtacatattggtgtttatggttaggtacacatgggtggttatggttaggtacatattggtgtttatggttaggtacatattggtgtttatggttaggtacatat

Function


NR:

description
PREDICTED: proteoglycan 4-like isoform X4

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1184224 True 1076 TUCP 0.36 2 13124924 13126167

Neighbor


gene id symbol gene type direction distance location
LOC110536984 strbp coding upstream 65039 12867389 ~ 13059885 (+)
dbh dbh coding upstream 766450 12308661 ~ 12358474 (+)
LOC110536981 NA coding upstream 959411 12157213 ~ 12165513 (+)
LOC110536980 LOC106568448 coding upstream 1012065 12108368 ~ 12112859 (+)
exd3 exd3 coding upstream 1024861 12035984 ~ 12100063 (+)
LOC110536991 morn5 coding downstream 302785 13428952 ~ 13439502 (+)
mrrf mrrf coding downstream 370446 13496613 ~ 13512145 (+)
anxa3b anxa3 coding downstream 410697 13536864 ~ 13545128 (+)
LOC110536999 NA coding downstream 466658 13592825 ~ 13595786 (+)
LOC118937681 LOC106568394 coding downstream 505260 13631427 ~ 13637704 (+)
G1039121 NA non-coding upstream 4272 13065381 ~ 13120652 (+)
G1039127 NA non-coding upstream 49706 13074270 ~ 13075218 (+)
G1039122 NA non-coding upstream 59618 13061342 ~ 13065306 (+)
G1039116 NA non-coding upstream 78331 13045510 ~ 13046593 (+)
G1039114 NA non-coding upstream 81417 13042492 ~ 13043507 (+)
G1039167 NA non-coding downstream 40241 13166408 ~ 13168178 (+)
G1039178 NA non-coding downstream 61295 13187462 ~ 13188804 (+)
G1039225 NA non-coding downstream 122997 13249164 ~ 13250069 (+)
G1039404 NA non-coding downstream 133292 13259459 ~ 13266242 (+)
G1039406 NA non-coding downstream 138383 13264550 ~ 13271848 (+)
LOC110536961 LOC106568434 other upstream 1552089 11568368 ~ 11602303 (+)
G1037472 NA other upstream 1669728 11452006 ~ 11455196 (+)
G1036562 LOC106568456 other upstream 2163801 10958408 ~ 10961123 (+)
G1036319 NA other upstream 2651851 10470315 ~ 10473073 (+)
ctif ctif other upstream 2694745 10237527 ~ 10430266 (+)
G1039430 LOC106568378 other downstream 156205 13282372 ~ 13283170 (+)
G1040196 NA other downstream 1039503 14165670 ~ 14169934 (+)
G1040578 NA other downstream 1290514 14416681 ~ 14416991 (+)
G1041168 LOC106568367 other downstream 1770191 14896358 ~ 14903843 (+)
G1041432 NA other downstream 2218752 15344919 ~ 15362742 (+)

Expression


G1039147 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1039147 Expression in each Bioproject

Bar chart with 20 bars.
G1039147 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network