G1039592



Basic Information


Item Value
gene id G1039592
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 13517237 ~ 13517529 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1184738
ggggccatgtatcgtgagattttgagtgaaaacctccttccatcagcaagggcattgaagatgaaacgtggctgggtcttttagcatgacaatgatcccaaacacaccgcccgggcaacgaaggagtggcttcgtaagaagcatttcaaggtcctggagtggcctagccagtctccagatctcaaccccatagaaaatctttggagggagttgaaagtccgtgttgcccagcaacagccccaaaacatcactgctctagaggagatctgcatggaggaatgggccaaaatacc

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1184738 True 293 lncRNA 0.51 1 13517237 13517529

Neighbor


gene id symbol gene type direction distance location
mrrf mrrf coding upstream 5092 13496613 ~ 13512145 (+)
LOC110536991 morn5 coding upstream 77735 13428952 ~ 13439502 (+)
LOC110536984 strbp coding upstream 457352 12867389 ~ 13059885 (+)
dbh dbh coding upstream 1158763 12308661 ~ 12358474 (+)
LOC110536981 NA coding upstream 1351724 12157213 ~ 12165513 (+)
anxa3b anxa3 coding downstream 19335 13536864 ~ 13545128 (+)
LOC110536999 NA coding downstream 75296 13592825 ~ 13595786 (+)
LOC118937681 LOC106568394 coding downstream 113898 13631427 ~ 13637704 (+)
LOC110536790 LOC106568394 coding downstream 120422 13637951 ~ 13655818 (+)
LOC110537002 arl15 coding downstream 149745 13667274 ~ 13733044 (+)
G1039557 NA non-coding upstream 43907 13472063 ~ 13473330 (+)
G1039554 NA non-coding upstream 48653 13467071 ~ 13468584 (+)
G1039526 LOC106568384 non-coding upstream 94283 13418269 ~ 13422954 (+)
G1039497 NA non-coding upstream 161302 13355262 ~ 13355935 (+)
G1039481 NA non-coding upstream 184991 13331930 ~ 13332246 (+)
G1039600 NA non-coding downstream 8593 13526122 ~ 13526346 (+)
G1039616 NA non-coding downstream 53896 13571425 ~ 13571635 (+)
G1039618 NA non-coding downstream 54373 13571902 ~ 13572130 (+)
G1039630 NA non-coding downstream 89654 13607183 ~ 13607655 (+)
G1039631 NA non-coding downstream 90831 13608360 ~ 13611478 (+)
G1039430 LOC106568378 other upstream 234067 13282372 ~ 13283170 (+)
G1039147 NA other upstream 391070 13124924 ~ 13126167 (+)
LOC110536961 LOC106568434 other upstream 1944402 11568368 ~ 11602303 (+)
G1037472 NA other upstream 2062041 11452006 ~ 11455196 (+)
G1036562 LOC106568456 other upstream 2556114 10958408 ~ 10961123 (+)
G1040196 NA other downstream 648141 14165670 ~ 14169934 (+)
G1040578 NA other downstream 899152 14416681 ~ 14416991 (+)
G1041168 LOC106568367 other downstream 1378829 14896358 ~ 14903843 (+)
G1041432 NA other downstream 1827390 15344919 ~ 15362742 (+)
G1041494 LOC106568352 other downstream 1947274 15464803 ~ 15564470 (+)

Expression


G1039592 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 40.
End of interactive chart.

G1039592 Expression in each Bioproject

Bar chart with 20 bars.
G1039592 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.

Co-expression Network