G1040509



Basic Information


Item Value
gene id G1040509
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 14375862 ~ 14376089 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1185790
CAGTATACTTTTACATGGATTCATTTTCTCATAAATCTCATACAATATATCTGCGTTTGAATTTCGAGTTGTGATGCGTAAATAAAGGCAGTGGTGCATTCAATGACCACTGAAAAGCATTATTAGATATGCCTCTCAAGATGAAGGGATTCAGATAACACATCAAAGTTCCTCTGCTTTAGATTCCTTAAATGACAAAACTAATCAGAATGTTCTGTCATTATAGAC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1185790 True 228 lncRNA 0.34 1 14375862 14376089
Loading

Neighbor


gene id symbol gene type direction distance location
tdgf1 LOC106568419 coding downstream 122914 14249910 ~ 14252948 (-)
zmp:0000001301 LOC106568410 coding downstream 162286 14198158 ~ 14213576 (-)
LOC110537014 LOC106568411 coding downstream 177835 14180403 ~ 14198027 (-)
LOC110537010 LOC106568408 coding downstream 220534 14120153 ~ 14155328 (-)
plpp1a plpp1 coding downstream 267668 14083339 ~ 14108194 (-)
LOC110537020 LOC106568373 coding upstream 453532 14829621 ~ 14831545 (-)
c3ar1 c3ar1 coding upstream 493650 14869739 ~ 14875572 (-)
LOC110537021 LOC106568367 coding upstream 520259 14896348 ~ 14946975 (-)
LOC110537023 NA coding upstream 693983 15070072 ~ 15075473 (-)
LOC110537026 LOC106568365 coding upstream 709828 15085917 ~ 15096696 (-)
G1040494 NA non-coding downstream 11022 14364491 ~ 14364840 (-)
G1040479 NA non-coding downstream 34053 14341556 ~ 14341809 (-)
G1040442 NA non-coding downstream 57259 14318361 ~ 14318603 (-)
G1040424 NA non-coding downstream 83724 14291934 ~ 14292138 (-)
G1040383 NA non-coding downstream 133853 14212095 ~ 14242009 (-)
G1040534 NA non-coding upstream 13514 14389603 ~ 14389823 (-)
G1040593 NA non-coding upstream 50380 14426469 ~ 14427273 (-)
G1040597 NA non-coding upstream 55631 14431720 ~ 14431933 (-)
G1040863 NA non-coding upstream 115185 14491274 ~ 14514588 (-)
G1040975 NA non-coding upstream 293968 14670057 ~ 14672944 (-)
G1040432 LOC106568413 other downstream 64810 14307600 ~ 14311052 (-)
G1040300 NA other downstream 195721 14178658 ~ 14180141 (-)
G1039504 NA other downstream 1020067 13355300 ~ 13355795 (-)
LOC110536986 LOC106568381 other downstream 1053146 13321118 ~ 13324415 (-)
G1039366 NA other downstream 1223555 13151021 ~ 13152307 (-)
G1042500 NA other upstream 1728074 16104163 ~ 16104883 (-)
LOC110537059 LOC106568318 other upstream 1948874 16324956 ~ 16328168 (-)
LOC110537061 LOC106568319 other upstream 2157528 16417638 ~ 16549073 (-)
LOC110537077 LOC106568284 other upstream 2689232 17065241 ~ 17068020 (-)
G1044482 NA other upstream 3320040 17696129 ~ 17697105 (-)

Expression


G1040509 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1040509 Expression in each Bioproject

Bar chart with 2 bars.
G1040509 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.

Co-expression Network